Order Kazusa clone(s) from :
Japan
||
Other countries |
Product ID | ORK06162 |
---|---|
Accession No | AB040913 |
Description | neuroligin 3 |
Clone name | fj05645 |
Vector information | |
cDNA sequence | DNA sequence (3154 bp) Predicted protein sequence (682 aa) |
Source | Human fetal brain |
Rouge ID |
mKIAA1480
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 1103 bp |
---|---|
Genome contig ID | gi89161218f_70190031 |
PolyA signal sequence (AATAAA,-25) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (117745 - 117794) |
----+----*----+----*----+----*----+----*----+----* |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.Result of homology search against HUGE database (FASTA output, Multiple alignment)
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
FPrintScan | IPR000460 | 304 | 318 | PR01090 | Neuroligin |
IPR000460 | 407 | 428 | PR01090 | Neuroligin | |
IPR000460 | 437 | 455 | PR01090 | Neuroligin | |
IPR000460 | 536 | 565 | PR01090 | Neuroligin | |
HMMPfam | IPR002018 | 1 | 458 | PF00135 | Carboxylesterase |
Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 542 | LSVTIAVGASLLFLNVLAFAAL | 563 | PRIMARY | 22 |
---|
RT-PCR-ELISA |
Primer_f | TGAACAACGTACTATGGAAGC |
---|---|
Primer_r | GACTGTAAAGAAAATGGGGCG |
PCR conditions | 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles |
Panel name | GeneBridge 4 |
---|---|
Primer_f | TGAACAACGTACTATGGAAGC |
Primer_r | GACTGTAAAGAAAATGGGGCG |
PCR product length | 113 bp |
PCR conditions | 95 °C15 sec62 °C60 sec30 cycles |