KIAA1489

Product ID	ORK05565
Accession No	AB040922
Description	kelch repeat and BTB (POZ) domain containing 2
Clone name	fj07905
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4330 bp) Predicted protein sequence (511 aa)
Source	Human fetal brain
Rouge ID	mKIAA1489 by Kazusa Mouse cDNA Project

Length: 4330 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	1175 bp
Genome contig ID	gi89161213r_32774308
PolyA signal sequence (AATAAA,-21)	+--------+--------+----*----+---- ACATTAATTTATTAAATAAATTGTATATATTCAAT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ATCTATTTTTCTTTTGTTATGGGAATGGTCTGCTTTTTAAATTTTGATTT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	7	r	32874308	32878635	1	99.0	Perfect prediction

Length: 511 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_001108122	100.0	kelch repeat an...	Macaca mulatta
Q8IY47	100.0	Kelch repeat an...	Homo sapiens
XP_001167768	99.8	kelch repeat an...	Pan troglodytes
Q5RDY3	99.6	Kelch repeat an...	Pongo abelii
XP_001167893	99.8	kelch repeat an...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB058745	1.5e-31	31.6	KIAA1842
AB037775	4.2e-18	25.0	KIAA1354
AB037730	2.4e-17	24.3	KIAA1309
AB037805	7.6e-16	25.4	KIAA1384
AB067508	1.4e-15	25.6	KIAA1921

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR011705	21	122	PF07707	BTB/Kelch-associated
	IPR006652	198	255	PF01344	Kelch repeat type 1
	IPR006652	257	304	PF01344	Kelch repeat type 1
	IPR006652	346	404	PF01344	Kelch repeat type 1
HMMSmart	IPR006652	205	268	SM00612	Kelch repeat type 1
	IPR006652	269	317	SM00612	Kelch repeat type 1
	IPR006652	318	357	SM00612	Kelch repeat type 1
	IPR006652	358	420	SM00612	Kelch repeat type 1

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	308	QWSAAVVVHDCIYVMTLNLMYC	329	PRIMARY	22

Primer_f	TTAACCTGTTGTGTGCGTGTG
Primer_r	ACCTGTGCTCATGTTAGATTG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	unigene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-