Order Kazusa clone(s) from : ![]() |
Product ID | ORK00411 |
---|---|
Accession No | D14696 |
Description | lysosomal protein transmembrane 4 alpha |
Clone name | ha00623 |
Vector information | |
cDNA sequence | DNA sequence (1402 bp) Predicted protein sequence (254 aa) |
HaloTag ORF Clone |
FHC00411
![]() |
Flexi ORF Clone | FXC00411 |
Source | Myeloblast cell line (KG-1) |
Rouge ID |
mKIAA0108
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 554 bp |
---|---|
Genome contig ID | gi89161199r_19995893 |
PolyA signal sequence (AATAAA,-21) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 2 | r | 20095893 | 20114908 | 7 | 100.0 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR004687 | 58 | 254 | PF03821 | Golgi 4-transmembrane spanning transporter |
HMMTigr | IPR004687 | 31 | 254 | TIGR00799 | Golgi 4-transmembrane spanning transporter |
Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 50 | TIILGTWYMVVNLLMAILLTVEV | 72 | PRIMARY | 23 | 2 | 98 | ADNACVLFAVSVLMFIISSMLVY | 120 | PRIMARY | 23 | 3 | 130 | LIPFFCYRLFDFVLSCLVAISSL | 152 | PRIMARY | 23 | 4 | 181 | CLLFIVLVFFALFIIFKAYLINC | 203 | PRIMARY | 23 |
---|
Panel name | Genebridge 4 |
---|---|
Primer_f | TTTGTTACTTGCTACCCTGAG |
Primer_r | CAACCATCATCTTCCACAGTC |
PCR product length | 148 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |