KIAA0045

Product ID	ORK07212
Accession No	D28476
Description	thyroid hormone receptor interactor 12, transcript variant 3
Clone name	ha00941
Vector information	The cDNA fragment was inserted at the EcoRV-NotI site of the ... The cDNA fragment was inserted at the EcoRV-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the EcoRV (blunt-end ligation) site without using any linker or adapter. The 3' end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (6428 bp) Predicted protein sequence (2005 aa)
Source	Myeloblast cell line (KG-1)

Length: 6428 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	340 bp
Genome contig ID	gi89161199r_230240174
PolyA signal sequence (AATAAA,-22)	+--------+--------+----*----+---- TCCAGGCTGGAACAATAAATGTGGCTGTGCAGTTT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AATTCTGGGCTGTGTGTATCCATCTAGCTAAGTCTGCAGTTTTCTTTCCT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	2	r	230340174	230494899	41	99.9	Perfect prediction

Length: 2005 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q14669	100.0	Probable E3 ubi...	Homo sapiens
XP_001138519	99.9	thyroid hormone...	Pan troglodytes
EAW70903	100.0	thyroid hormone...	Homo sapiens
EAW70908	99.7	thyroid hormone...	Homo sapiens
XP_850221	99.1	similar to thyr...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB032957	5.3e-13	30.5	KIAA1131
AB037741	2.9e-07	25.4	KIAA1320
AB046845	1e-06	25.4	KIAA1625
AB007899	1.4e-06	24.1	KIAA0439
D42055	1.6e-06	27.4	KIAA0093

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR004170	762	797	PF02825	WWE
HMMPfam	IPR000569	1649	2005	PF00632	HECT
HMMSmart	IPR000569	1616	2005	SM00119	HECT
ProfileScan	IPR004170	762	849	PS50918	WWE
ProfileScan	IPR000569	1608	2005	PS50237	HECT

Primer_f
Primer_r
PCR conditions	test

Panel name	Stanford G3
Primer_f	TTTGATAATGAGCAGCAGAGG
Primer_r	ATTACAGAGGGCAAGAAGTCA
PCR product length	155 bp
PCR conditions	95 °C15 sec66 °C60 sec30 cycles