Order Kazusa clone(s) from :
Japan
||
Other countries |
Product ID | ORK00420 |
---|---|
Accession No | D50922 |
Description | kelch-like ECH-associated protein 1, transcript variant 2 |
Clone name | ha01449s1 |
Vector information | |
cDNA sequence | DNA sequence (2513 bp) Predicted protein sequence (637 aa) |
HaloTag ORF Clone |
FHC00420
|
Flexi ORF Clone | FXC00420 |
Source | Myeloblast cell line (KG-1) |
Rouge ID |
mKIAA0132
by Kazusa Mouse cDNA Project
|
Note | We replaced ha01449, former representative clones for KIAA0132 with ha01449s1. (2008/12/19) |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 526 bp |
---|---|
Genome contig ID | gi42406306r_10357802 |
PolyA signal sequence (AATAAA,-29) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.Result of homology search against HUGE database (FASTA output, Multiple alignment)
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
FPrintScan | IPR006651 | 576 | 589 | PR00501 | Kelch motif |
IPR006651 | 593 | 607 | PR00501 | Kelch motif | |
HMMPfam | IPR013069 | 80 | 192 | PF00651 | BTB/POZ |
IPR011705 | 197 | 299 | PF07707 | BTB/Kelch-associated | |
IPR006652 | 328 | 372 | PF01344 | Kelch repeat | |
IPR011498 | 374 | 423 | PF07646 | Kelch | |
IPR006652 | 374 | 423 | PF01344 | Kelch repeat | |
IPR011498 | 425 | 470 | PF07646 | Kelch | |
IPR006652 | 425 | 470 | PF01344 | Kelch repeat | |
IPR011498 | 472 | 517 | PF07646 | Kelch | |
IPR006652 | 472 | 517 | PF01344 | Kelch repeat | |
IPR011498 | 519 | 564 | PF07646 | Kelch | |
IPR006652 | 519 | 564 | PF01344 | Kelch repeat | |
IPR011498 | 566 | 611 | PF07646 | Kelch | |
IPR006652 | 566 | 611 | PF01344 | Kelch repeat | |
HMMSmart | IPR000210 | 90 | 192 | SM00225 | BTB |
ProfileScan | IPR000210 | 90 | 162 | PS50097 | BTB |
Primer_f | |
---|---|
Primer_r | |
PCR conditions | test |
Panel name | Genebridge 4 |
---|---|
Primer_f | TTACGACCCAGATACAGACAC |
Primer_r | TTCTGCTGGTCAATCTGCTTC |
PCR product length | 114 bp |
PCR conditions | 95 °C15 sec62 °C60 sec30 cycles |