KIAA0050

Product ID	ORK00386
Accession No	D30758
Description	ArfGAP with coiled-coil, ankyrin repeat and PH domains 1
Clone name	ha01557
Vector information	The cDNA fragment was inserted at the EcoRV-NotI site of the ... The cDNA fragment was inserted at the EcoRV-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the EcoRV (blunt-end ligation) site without using any linker or adapter. The 3' end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (2494 bp) Predicted protein sequence (796 aa)
HaloTag ORF Clone	FHC00386
Flexi ORF Clone	FXC00386
Source	Myeloblast cell line (KG-1)
Rouge ID	mKIAA0050 by Kazusa Mouse cDNA Project

Length: 2494 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	83 bp
Genome contig ID	gi51511734f_7080590
PolyA signal sequence (ATTAAA,-27)	+--------+--------+----*----+---- CCTCTGCCATTAAAGCCTCCGTGCTTCGCTCTTCC
Flanking genome sequence (114933 - 114982)	----+--------+--------+--------+--------+----* CTTCTGGTTCACTTCTTGGGCGCCACCTTCGGGCCCGTAGGGTGTTGGGC

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	17	f	7180590	7195521	22	100.0	Perfect prediction

Length: 796 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q15027	100.0	ARFGAP with coi...	Homo sapiens
A5PK26	93.7	ARFGAP with coi...	Bos taurus
Q8K2H4	93.1	ARFGAP with coi...	Mus musculus
BAE32594	93.0	unnamed protein...	Mus musculus
XP_001169930	98.3	centaurin beta1...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
D26069	3.2e-58	51.5	KIAA0041
AB051503	5.6e-55	49.5	KIAA1716
AB029022	2.6e-09	35.8	KIAA1099
AB075855	3.1e-09	37.6	KIAA1975
D79989	1.9e-08	35.1	KIAA0167

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR001164	473	492	PR00405	Arf GTPase activating protein
	IPR001164	492	509	PR00405	Arf GTPase activating protein
	IPR001164	513	534	PR00405	Arf GTPase activating protein
	IPR002110	696	708	PR01415	Ankyrin
	IPR002110	708	720	PR01415	Ankyrin
HMMPfam	IPR001849	322	416	PF00169	Pleckstrin-like
	IPR001164	461	583	PF01412	Arf GTPase activating protein
	IPR002110	662	694	PF00023	Ankyrin
	IPR002110	695	727	PF00023	Ankyrin
	IPR002110	728	748	PF00023	Ankyrin
HMMSmart	IPR001849	322	418	SM00233	Pleckstrin-like
	IPR001164	461	583	SM00105	Arf GTPase activating protein
	IPR002110	662	691	SM00248	Ankyrin
	IPR002110	695	724	SM00248	Ankyrin
	IPR002110	728	758	SM00248	Ankyrin
ProfileScan	IPR000909	132	196	PS50007	Phosphatidylinositol-specific phospholipase C
	IPR001849	321	416	PS50003	Pleckstrin-like
	IPR001164	461	583	PS50115	Arf GTPase activating protein
	IPR002110	648	748	PS50297	Ankyrin
	IPR002110	662	694	PS50088	Ankyrin
	IPR002110	695	727	PS50088	Ankyrin

Primer_f
Primer_r
PCR conditions	test

Panel name	Genebridge 4
Primer_f	TTTGTGCTGCGTTTGGTGGAG
Primer_r	GTCCCTCTTCTCTCGTGCTGA
PCR product length	141 (0.2k) bp
PCR conditions	95 °C15 sec66 °C60 sec30 cycles