KIAA0224

Product ID	ORK00469
Accession No	D86977
Description	DEAH (Asp-Glu-Ala-His) box polypeptide 38
Clone name	ha04657
Vector information	The cDNA fragment was inserted at the EcoRV-NotI site of the ... The cDNA fragment was inserted at the EcoRV-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the EcoRV (blunt-end ligation) site without using any linker or adapter. The 3' end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4226 bp) Predicted protein sequence (1256 aa)
HaloTag ORF Clone	FHC00469
Flexi ORF Clone	FXC00469
Source	Myeloblast cell line (KG-1)
Rouge ID	mKIAA0224 by Kazusa Mouse cDNA Project

Length: 4226 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	406 bp
Genome contig ID	gi51511732f_70585335
PolyA signal sequence (AATAAA,-18)	+--------+--------+----*----+---- ATAATTCAGGATTTGGAAATAAATTTATTATTTGT
Flanking genome sequence (118970 - 119019)	----+--------+--------+--------+--------+----* AAAACATGACTGCATGTCTGACTTTTTCCTTCACCCTCTTAAATCATGTA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	16	f	70685335	70704303	27	99.7	Perfect prediction

Length: 1256 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_511101	99.7	DEAH (Asp-Glu-A...	Pan troglodytes
XP_001097681	99.3	similar to DEAH...	Macaca mulatta
AAC39729	100.0	pre-mRNA splici...	Homo sapiens
BAF84323	99.8	unnamed protein...	Homo sapiens
CAH92898	99.1	hypothetical pr...	Pongo abelii

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB011149	6.5e-85	41.0	KIAA0577
AB040921	3.9e-19	30.0	KIAA1488
D50924	1.7e-16	36.5	KIAA0134
AB020697	1.8e-14	30.2	KIAA0890
AB040950	7.8e-13	30.9	KIAA1517

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001650	796	890	PF00271	DNA/RNA helicase
	IPR007502	951	1041	PF04408	Helicase-associated region
	IPR011709	1075	1177	PF07717	Domain of unknown function DUF1605
HMMSmart	IPR014001	559	743	SM00487	DEAD-like helicases
HMMSmart	IPR001650	787	890	SM00490	DNA/RNA helicase
ProfileScan	IPR014021	571	734	PS51192	Helicase
ProfileScan	IPR001650	756	931	PS51194	DNA/RNA helicase
ScanRegExp	IPR002464	676	685	PS00690	DNA/RNA helicase

Primer_f
Primer_r
PCR conditions	test

Panel name	Genebridge 4
Primer_f	GGCTGCAGAGTATCCGAGGTG
Primer_r	CAGCCAAGTCACGCATACACC
PCR product length	101 bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles