KIAA0294

Product ID	ORK01064
Accession No	AB002292
Description	Rho guanine nucleotide exchange factor (GEF) 10, transcript variant 1
Clone name	hf00223s1
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5589 bp) Predicted protein sequence (1405 aa)
HaloTag ORF Clone	FHC01064
Flexi ORF Clone	FXC01064
Source	Human adult brain
Rouge ID	mKIAA0294 by Kazusa Mouse cDNA Project
Note	We replaced hf00223, former representative clones for KIAA0294 with hf00223s1. (2002/5/10)

Length: 5589 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	1370 bp
Genome contig ID	gi51511724f_1678924
PolyA signal sequence (AATAAA,-19)	+--------+--------+----*----+---- GCTGTCTGACTTCATCAATAAAGTATTTTTATTTT
Flanking genome sequence (215284 - 215333)	----+--------+--------+--------+--------+----* AAAATGCAGTAGGATGAGTTGCCTCTTTTCTGTGTCAAGTGGAAAGGGAC

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	8	f	1759549	1894206	29	99.6	Perfect prediction

Length: 1405 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
O15013	99.9	Rho guanine nuc...	Homo sapiens
EAW51484	100.0	Rho guanine nuc...	Homo sapiens
XP_528056	96.0	Rho guanine nuc...	Pan troglodytes
EAW51481	99.9	Rho guanine nuc...	Homo sapiens
EAW51483	100.0	Rho guanine nuc...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB046846	5.8e-86	46.1	KIAA1626
AB002335	1.2e-15	24.0	KIAA0337
AB028989	8.1e-09	30.0	KIAA1066
AB011088	2.2e-08	26.1	KIAA0516
AB037783	1.8e-06	25.8	KIAA1362

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000219	461	643	PF00621	DH
HMMSmart	IPR000219	461	643	SM00325	DH
ProfileScan	IPR000219	457	644	PS50010	DH
ScanRegExp	IPR000169	1205	1215	PS00639	Peptidase

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	1145	GMVISHMAVSGVGIWIAFTSGST	1167	SECONDARY	23
SOSUI2	2	1201	TSLLVCHGLLMVGTSLGVLVALP	1223	PRIMARY	23

Primer_f	TCTTAAAATCTACCGCCAACG
Primer_r	ACACCTCCATCTACTATTCGG
PCR conditions	95 °C15 sec62 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	TCTTAAAATCTACCGCCAACG
Primer_r	ACACCTCCATCTACTATTCGG
PCR product length	110 bp
PCR conditions	95 °C15 sec62 °C60 sec30 cycles