Order Kazusa clone(s) from : ![]() |
Product ID | ORK01066 |
---|---|
Accession No | AB002320 |
Description | HECT, C2 and WW domain containing E3 ubiquitin protein ligase 1, transcript variant 1 |
Clone name | hg00462s1 |
Vector information | |
cDNA sequence | DNA sequence (6838 bp) Predicted protein sequence (1614 aa) |
HaloTag ORF Clone |
FHC01066
![]() |
Flexi ORF Clone | FXC01066 |
Source | Human adult brain |
Rouge ID |
mKIAA0322
by Kazusa Mouse cDNA Project
|
Note | We replaced hg00462, former representative clones for KIAA0322 with hg00462s1. (2002/5/10) |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 1412 bp |
---|---|
Genome contig ID | gi89161213f_43018723 |
PolyA signal sequence (AATAAA,-21) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (550742 - 550791) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 7 | f | 43118723 | 43569463 | 30 | 99.5 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR000008 | 215 | 310 | PF00168 | C2 calcium-dependent membrane targeting |
IPR001202 | 839 | 868 | PF00397 | WW/Rsp5/WWP | |
IPR001202 | 1028 | 1057 | PF00397 | WW/Rsp5/WWP | |
IPR000569 | 1309 | 1614 | PF00632 | HECT | |
HMMSmart | IPR000008 | 214 | 325 | SM00239 | C2 calcium-dependent membrane targeting |
IPR001202 | 838 | 870 | SM00456 | WW/Rsp5/WWP | |
IPR001202 | 1027 | 1059 | SM00456 | WW/Rsp5/WWP | |
IPR000569 | 1277 | 1614 | SM00119 | HECT | |
ProfileScan | IPR000008 | 214 | 310 | PS50004 | C2 calcium-dependent membrane targeting |
IPR001202 | 837 | 870 | PS50020 | WW/Rsp5/WWP | |
IPR001202 | 1026 | 1059 | PS50020 | WW/Rsp5/WWP | |
IPR000569 | 1279 | 1614 | PS50237 | HECT | |
ScanRegExp | IPR001202 | 843 | 868 | PS01159 | WW/Rsp5/WWP |
IPR001202 | 1032 | 1057 | PS01159 | WW/Rsp5/WWP |
![]() |
---|
Primer_f | AATGTAGTTGAGAGGTTAGGC |
---|---|
Primer_r | AACATAACACCCCAAAGGCAC |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | GeneBridge 4 |
---|---|
Primer_f | AATGTAGTTGAGAGGTTAGGC |
Primer_r | AACATAACACCCCAAAGGCAC |
PCR product length | 147 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |