KIAA0322

Product ID	ORK01066
Accession No	AB002320
Description	HECT, C2 and WW domain containing E3 ubiquitin protein ligase 1, transcript variant 1
Clone name	hg00462s1
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (6838 bp) Predicted protein sequence (1614 aa)
HaloTag ORF Clone	FHC01066
Flexi ORF Clone	FXC01066
Source	Human adult brain
Rouge ID	mKIAA0322 by Kazusa Mouse cDNA Project
Note	We replaced hg00462, former representative clones for KIAA0322 with hg00462s1. (2002/5/10)

Length: 6838 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	1412 bp
Genome contig ID	gi89161213f_43018723
PolyA signal sequence (AATAAA,-21)	+--------+--------+----*----+---- TCAACTACATTTGAAATAAACCCAACCATAATGGT
Flanking genome sequence (550742 - 550791)	----+--------+--------+--------+--------+----* CATTTGCTATTTTTCTAACGTTGTTATCCATGTTGCCTGAAATAGGTCAT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	7	f	43118723	43569463	30	99.5	Perfect prediction

Length: 1614 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EAW94160	99.9	HECT, C2 and WW...	Homo sapiens
Q76N89	100.0	E3 ubiquitin-pr...	Homo sapiens
NP_055867	99.9	NEDD4-like ubiq...	Homo sapiens
EAW94158	99.8	HECT, C2 and WW...	Homo sapiens
XP_001096775	99.1	similar to HECT...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB037722	1.1e-131	57.1	KIAA1301
AB007899	1.5e-43	35.0	KIAA0439
D42055	4.2e-43	36.4	KIAA0093
AB046845	1.8e-38	46.9	KIAA1625
AB002310	3.6e-31	42.0	KIAA0312

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000008	215	310	PF00168	C2 calcium-dependent membrane targeting
	IPR001202	839	868	PF00397	WW/Rsp5/WWP
	IPR001202	1028	1057	PF00397	WW/Rsp5/WWP
	IPR000569	1309	1614	PF00632	HECT
HMMSmart	IPR000008	214	325	SM00239	C2 calcium-dependent membrane targeting
	IPR001202	838	870	SM00456	WW/Rsp5/WWP
	IPR001202	1027	1059	SM00456	WW/Rsp5/WWP
	IPR000569	1277	1614	SM00119	HECT
ProfileScan	IPR000008	214	310	PS50004	C2 calcium-dependent membrane targeting
	IPR001202	837	870	PS50020	WW/Rsp5/WWP
	IPR001202	1026	1059	PS50020	WW/Rsp5/WWP
	IPR000569	1279	1614	PS50237	HECT
ScanRegExp	IPR001202	843	868	PS01159	WW/Rsp5/WWP
ScanRegExp	IPR001202	1032	1057	PS01159	WW/Rsp5/WWP

Primer_f	AATGTAGTTGAGAGGTTAGGC
Primer_r	AACATAACACCCCAAAGGCAC
PCR conditions	95 °C30 sec61 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	AATGTAGTTGAGAGGTTAGGC
Primer_r	AACATAACACCCCAAAGGCAC
PCR product length	147 bp
PCR conditions	95 °C15 sec62 °C60 sec30 cycles