Order Kazusa clone(s) from : ![]() |
Product ID | ORK01975 |
---|---|
Accession No | AB007925 |
Description | SLIT-ROBO Rho GTPase activating protein 2, transcript variant 1 |
Clone name | hg00633 |
Vector information | |
cDNA sequence | DNA sequence (6305 bp) Predicted protein sequence (1095 aa) |
HaloTag ORF Clone |
FHC01975
![]() |
Flexi ORF Clone | FXC01975 |
Source | Human adult brain |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
BlastProDom | IPR001452 | 757 | 806 | PD000066 | Src homology-3 |
FPrintScan | IPR001452 | 769 | 784 | PR00452 | Src homology-3 |
IPR001452 | 786 | 795 | PR00452 | Src homology-3 | |
IPR001452 | 797 | 809 | PR00452 | Src homology-3 | |
HMMPfam | IPR001060 | 46 | 144 | PF00611 | Cdc15/Fes/CIP4 |
IPR000198 | 529 | 681 | PF00620 | RhoGAP | |
IPR001452 | 755 | 809 | PF00018 | Src homology-3 | |
HMMSmart | IPR001060 | 46 | 144 | SM00055 | Cdc15/Fes/CIP4 |
IPR000198 | 526 | 700 | SM00324 | RhoGAP | |
IPR001452 | 755 | 810 | SM00326 | Src homology-3 | |
ProfileScan | IPR001060 | 46 | 111 | PS50133 | Cdc15/Fes/CIP4 |
IPR000198 | 513 | 703 | PS50238 | RhoGAP | |
IPR001452 | 752 | 811 | PS50002 | Src homology-3 |
Primer_f | |
---|---|
Primer_r | |
PCR conditions | °C![]() ![]() ![]() ![]() ![]() |
Panel name | GeneBridge 4 |
---|---|
Primer_f | CACAACATTGCGATTCCCTGG |
Primer_r | AGGAGATGAGGAGCGGTGATG |
PCR product length | 117 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |