|
Order Kazusa clone(s) from : |
| Product ID | ORK01975 |
|---|---|
| Accession No | AB007925 |
| Description | SLIT-ROBO Rho GTPase activating protein 2, transcript variant 1 |
| Clone name | hg00633 |
| Vector information | |
| cDNA sequence | DNA sequence (6305 bp) Predicted protein sequence (1095 aa) |
|
HaloTag ORF Clone |
FHC01975
|
| Flexi ORF Clone | FXC01975 |
| Source | Human adult brain |
Length: 6305 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).
| N-terminal truncation | Coding interruption | |
|---|---|---|
| cloned DNA seq | Warning | No warning |
Length: 1095 aa
Result of homology search against nr database
(FASTA output,
Multiple alignment)![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database
(FASTA output,
Multiple alignment)![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)
Result of InterProScan
| Search method | interpro_ID | From | To | Entry | Definition |
|---|---|---|---|---|---|
| BlastProDom | IPR001452 | 757 | 806 | PD000066 | Src homology-3 |
| FPrintScan | IPR001452 | 769 | 784 | PR00452 | Src homology-3 |
| IPR001452 | 786 | 795 | PR00452 | Src homology-3 | |
| IPR001452 | 797 | 809 | PR00452 | Src homology-3 | |
| HMMPfam | IPR001060 | 46 | 144 | PF00611 | Cdc15/Fes/CIP4 |
| IPR000198 | 529 | 681 | PF00620 | RhoGAP | |
| IPR001452 | 755 | 809 | PF00018 | Src homology-3 | |
| HMMSmart | IPR001060 | 46 | 144 | SM00055 | Cdc15/Fes/CIP4 |
| IPR000198 | 526 | 700 | SM00324 | RhoGAP | |
| IPR001452 | 755 | 810 | SM00326 | Src homology-3 | |
| ProfileScan | IPR001060 | 46 | 111 | PS50133 | Cdc15/Fes/CIP4 |
| IPR000198 | 513 | 703 | PS50238 | RhoGAP | |
| IPR001452 | 752 | 811 | PS50002 | Src homology-3 |
Experimental conditions| Primer_f | |
|---|---|
| Primer_r | |
| PCR conditions | °C sec °C sec cycles![]() |
Chromosome No. 1
Experimental conditions| Panel name | GeneBridge 4 |
|---|---|
| Primer_f | CACAACATTGCGATTCCCTGG |
| Primer_r | AGGAGATGAGGAGCGGTGATG |
| PCR product length | 117 bp |
| PCR conditions | 95 °C 15 sec 64 °C 60 sec 30 cycles |