Order Kazusa clone(s) from :
Japan
||
Other countries |
Product ID | ORK01983 |
---|---|
Accession No | AB011175 |
Description | TBC1 domain family, member 4, transcript variant 1 |
Clone name | hg01488b |
Vector information | |
cDNA sequence | DNA sequence (5922 bp) Predicted protein sequence (1348 aa) |
HaloTag ORF Clone |
FHC01983
|
Flexi ORF Clone | FXC01983 |
Source | Human adult brain |
Rouge ID |
mKIAA0603
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.Result of homology search against HUGE database (FASTA output, Multiple alignment)
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR006020 | 179 | 237 | PF00640 | Phosphotyrosine interaction region |
IPR000195 | 965 | 1184 | PF00566 | RabGAP/TBC | |
HMMSmart | IPR006020 | 80 | 240 | SM00462 | Phosphotyrosine interaction region |
IPR006020 | 246 | 499 | SM00462 | Phosphotyrosine interaction region | |
IPR000195 | 965 | 1185 | SM00164 | RabGAP/TBC | |
ProfileScan | IPR006020 | 415 | 487 | PS01179 | Phosphotyrosine interaction region |
IPR000195 | 968 | 1162 | PS50086 | RabGAP/TBC |
Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 1145 | QFSLGFVARVFDIIFLQGTEVIF | 1167 | PRIMARY | 23 |
---|
RT-PCR |
---|
Primer_f | CTCTTCACTTCCTCAGCCTAC |
---|---|
Primer_r | TTACTTTCCTTGCCTATACCC |
PCR conditions | 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles |
Panel name | GeneBridge 4 |
---|---|
Primer_f | CTCTTCACTTCCTCAGCCTAC |
Primer_r | TTACTTTCCTTGCCTATACCC |
PCR product length | 74 bp |
PCR conditions | 95 °C15 sec62 °C60 sec30 cycles |