Order Kazusa clone(s) from : ![]() |
Product ID | ORK01072 |
---|---|
Accession No | AB002354 |
Description | pleckstrin homology domain containing, family M (with RUN domain) member 1, transcript variant 1 |
Clone name | hh00006s1 |
Vector information | |
cDNA sequence | DNA sequence (5248 bp) Predicted protein sequence (1058 aa) |
HaloTag ORF Clone |
FHC01072
![]() |
Flexi ORF Clone | FXC01072 |
Source | Human adult brain |
Rouge ID |
mKIAA0356
by Kazusa Mouse cDNA Project
|
Note | We replaced hh00006, former representative clones for KIAA0356 with hh00006s1. (2002/12/27) |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR004012 | 51 | 185 | PF02759 | RUN |
IPR001849 | 537 | 627 | PF00169 | Pleckstrin-like | |
HMMSmart | IPR004012 | 120 | 183 | SM00593 | RUN |
IPR001849 | 537 | 629 | SM00233 | Pleckstrin-like | |
IPR001849 | 686 | 781 | SM00233 | Pleckstrin-like | |
IPR002219 | 989 | 1042 | SM00109 | Protein kinase C | |
ProfileScan | IPR004012 | 43 | 185 | PS50826 | RUN |
IPR001849 | 536 | 627 | PS50003 | Pleckstrin-like | |
IPR002219 | 988 | 1042 | PS50081 | Protein kinase C |
![]() |
---|
Primer_f | ATTCAAAACTCACACGGCAGC |
---|---|
Primer_r | TGCATTGACTCTTCCCGCCTC |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | GeneBridge 4 |
---|---|
Primer_f | ATTCAAAACTCACACGGCAGC |
Primer_r | TGCATTGACTCTTCCCGCCTC |
PCR product length | 159 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |