Gene/Protein Characteristic Table for KIAA0379
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK00521
Accession No AB002377
Description ankyrin repeat domain 28, transcript variant 1
Clone name hh00505s1
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (4408 bp)
Predicted protein sequence (1059 aa)
Flexi ORF Clone FXC00521
Source Human adult brain
Rouge ID mKIAA0379 by Kazusa Mouse cDNA Project
Note We replaced hh00505, former representative clones for KIAA0379 with hh00505s1. (2002/5/10)
Features of the cloned cDNA sequence
Description

Length: 4408 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq Warning No warning
Integrity of 3' end
Length of 3'UTR 1227 bp
Genome contig ID gi89161205r_15583750
PolyA signal sequence
(AATAAA,-21)		 
+----*----+----*----+----*----+----
GACCTTTTAAAAGAAATAAAGTTTTTTAATGCAAT
Flanking genome sequence
(100000 - 99951)		 
----+----*----+----*----+----*----+----*----+----*
AAATCAAGTGTCTGTCTCTTTTACATGCAAACTTCTTTTCCCTTAAACTG

Ensembl ContigView (Add our DAS server as a DAS source)


Chr f/r start end exon identity class
Ensembl gnome browser 3 r 15683750 15875933 29 99.8 Perfect prediction
Features of the protein sequence
Description

Length: 1059 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
EAW64259 0 100.0 ankyrin repeat ...
 Homo sapiens
XP_534254 0 99.0 similar to anky...
 Canis lupus fam...
XP_516310 0 99.8 ankyrin repeat ...
 Pan troglodytes
O15084 0 100.0 Serine/threonin...
 Homo sapiens
EDL24818 0 98.2 ankyrin repeat ...
 Mus musculus
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
Entry Exp ID% HUGE_ID
AB033049 3.7e-32 32.8 KIAA1223
AB033076 4e-26 28.6 KIAA1250
AB014597 8.1e-25 26.7 KIAA0697
D86982 1.5e-18 37.4 KIAA0229
AB037755 6.2e-18 31.3 KIAA1334
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
FPrintScan IPR002110 345 357 PR01415 Ankyrin
IPR002110 704 716 PR01415 Ankyrin
HMMPfam IPR002110 21 45 PF00023 Ankyrin
IPR002110 46 78 PF00023 Ankyrin
IPR002110 79 111 PF00023 Ankyrin
IPR002110 112 144 PF00023 Ankyrin
IPR002110 145 177 PF00023 Ankyrin
IPR002110 178 210 PF00023 Ankyrin
IPR002110 211 243 PF00023 Ankyrin
IPR002110 244 276 PF00023 Ankyrin
IPR002110 277 310 PF00023 Ankyrin
IPR002110 311 343 PF00023 Ankyrin
IPR002110 344 376 PF00023 Ankyrin
IPR002110 377 409 PF00023 Ankyrin
IPR002110 410 442 PF00023 Ankyrin
IPR002110 443 475 PF00023 Ankyrin
IPR002110 476 509 PF00023 Ankyrin
IPR002110 510 543 PF00023 Ankyrin
IPR002110 558 587 PF00023 Ankyrin
IPR002110 588 620 PF00023 Ankyrin
IPR002110 622 654 PF00023 Ankyrin
IPR002110 658 690 PF00023 Ankyrin
IPR002110 691 723 PF00023 Ankyrin
IPR002110 724 753 PF00023 Ankyrin
IPR002110 761 784 PF00023 Ankyrin
IPR002110 793 826 PF00023 Ankyrin
IPR002110 828 860 PF00023 Ankyrin
IPR002110 861 894 PF00023 Ankyrin
IPR002110 895 927 PF00023 Ankyrin
IPR002110 931 963 PF00023 Ankyrin
HMMSmart IPR002110 13 42 SM00248 Ankyrin
IPR002110 46 75 SM00248 Ankyrin
IPR002110 79 108 SM00248 Ankyrin
IPR002110 112 141 SM00248 Ankyrin
IPR002110 145 174 SM00248 Ankyrin
IPR002110 178 207 SM00248 Ankyrin
IPR002110 211 240 SM00248 Ankyrin
IPR002110 244 273 SM00248 Ankyrin
IPR002110 277 307 SM00248 Ankyrin
IPR002110 311 340 SM00248 Ankyrin
IPR002110 344 373 SM00248 Ankyrin
IPR002110 377 406 SM00248 Ankyrin
IPR002110 410 439 SM00248 Ankyrin
IPR002110 443 472 SM00248 Ankyrin
IPR002110 476 506 SM00248 Ankyrin
IPR002110 510 540 SM00248 Ankyrin
IPR002110 555 584 SM00248 Ankyrin
IPR002110 588 617 SM00248 Ankyrin
IPR002110 622 651 SM00248 Ankyrin
IPR002110 658 687 SM00248 Ankyrin
IPR002110 691 720 SM00248 Ankyrin
IPR002110 724 753 SM00248 Ankyrin
IPR002110 761 791 SM00248 Ankyrin
IPR002110 793 824 SM00248 Ankyrin
IPR002110 828 857 SM00248 Ankyrin
IPR002110 861 891 SM00248 Ankyrin
IPR002110 895 924 SM00248 Ankyrin
IPR002110 931 960 SM00248 Ankyrin
ProfileScan IPR002110 13 997 PS50297 Ankyrin
IPR002110 46 78 PS50088 Ankyrin
IPR002110 79 111 PS50088 Ankyrin
IPR002110 112 144 PS50088 Ankyrin
IPR002110 145 177 PS50088 Ankyrin
IPR002110 178 210 PS50088 Ankyrin
IPR002110 211 243 PS50088 Ankyrin
IPR002110 244 276 PS50088 Ankyrin
IPR002110 277 310 PS50088 Ankyrin
IPR002110 311 343 PS50088 Ankyrin
IPR002110 344 376 PS50088 Ankyrin
IPR002110 377 409 PS50088 Ankyrin
IPR002110 410 442 PS50088 Ankyrin
IPR002110 443 475 PS50088 Ankyrin
IPR002110 476 509 PS50088 Ankyrin
IPR002110 555 587 PS50088 Ankyrin
IPR002110 588 620 PS50088 Ankyrin
IPR002110 622 654 PS50088 Ankyrin
IPR002110 658 690 PS50088 Ankyrin
IPR002110 691 723 PS50088 Ankyrin
IPR002110 724 756 PS50088 Ankyrin
IPR002110 761 783 PS50088 Ankyrin
IPR002110 828 860 PS50088 Ankyrin
IPR002110 861 894 PS50088 Ankyrin
IPR002110 931 963 PS50088 Ankyrin
Expression profile
Description

RT-PCR
Experimental conditions
Primer_f CCCCAAAATTTACAGCTACAC
Primer_r GCTCTAGAACTACTTTGGGTG
PCR conditions 95 °C30 sec61 °C30 sec72 °C60 sec30 cycles

RH mapping information
Description

Chromosome No. 3
Experimental conditions
Panel name GeneBridge 4
Primer_f CCCCAAAATTTACAGCTACAC
Primer_r GCTCTAGAACTACTTTGGGTG
PCR product length 121 bp
PCR conditions 95 °C15 sec62 °C60 sec30 cycles
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp