KIAA0932

Product ID	ORK00687
Accession No	AB023149
Description	tolloid-like 2
Clone name	hh04016s1
Vector information	The cDNA fragment was originally inserted at SalI-NotI site ... The cDNA fragment was originally inserted at SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR) and a RT-PCR product (1-706) was subcloned upstream of the cDNA (707-6717). The adjacent sequence to the 5' end of the cDNA is as follows: GGGCCCCCCC TCGAGGTCGA CGGTATCGAT AAGCTTGATT-5' end of cDNA
cDNA sequence	DNA sequence (6717 bp) Predicted protein sequence (1078 aa)
HaloTag ORF Clone	FHC00687
Flexi ORF Clone	FXC00687
Source	Human adult brain
Note	We replaced hh04016, former representative clones for KIAA0932 with hh04016s1. (2003/8/28)

Length: 6717 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	3478 bp
Genome contig ID	gi89161187r_98014356
PolyA signal sequence (ATTAAA,-18)	+--------+--------+----*----+---- CTAGAAAGGATGGTTTCATTAAAGAATGTGGATTT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ATTGATGTGTCTTGGGTTTGTATTGCTAATTCAGACCAGATGGGTCCTTT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	10	r	98114356	98263623	21	99.4	Perfect prediction

Length: 1078 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_507953	99.3	tolloid-like 2 ...	Pan troglodytes
BAG09904	100.0	tolloid-like pr...	synthetic construct
Q9Y6L7	99.9	Tolloid-like pr...	Homo sapiens
BAF51675	93.5	tolloid-like 2 ...	Microcebus murinus
BAF51667	93.5	tolloid-like 2 ...	Eulemur macaco

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB067477	1.3e-13	25.3	KIAA1890
AB067481	5.1e-09	28.0	KIAA1894
AB023144	5.6e-06	24.2	KIAA0927
AB011539	1.9e-05	29.3	KIAA0815
AB011541	4.5e-05	36.3	KIAA0817

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR001506	243	261	PR00480	Peptidase M12A
	IPR001506	297	315	PR00480	Peptidase M12A
	IPR001506	316	333	PR00480	Peptidase M12A
	IPR001506	355	370	PR00480	Peptidase M12A
	IPR001506	397	410	PR00480	Peptidase M12A
HMMPfam	IPR001506	220	413	PF01400	Peptidase M12A
	IPR000859	414	523	PF00431	CUB
	IPR000859	527	636	PF00431	CUB
	IPR013091	640	679	PF07645	EGF calcium-binding
	IPR000859	683	792	PF00431	CUB
	IPR006209	799	834	PF00008	EGF-like
	IPR000859	839	948	PF00431	CUB
	IPR000859	952	1065	PF00431	CUB
HMMSmart	IPR006026	218	360	SM00235	Peptidase
	IPR000859	414	526	SM00042	CUB
	IPR000859	527	639	SM00042	CUB
	IPR001881	639	680	SM00179	EGF-like calcium-binding
	IPR006210	642	680	SM00181	EGF
	IPR000859	683	795	SM00042	CUB
	IPR001881	795	835	SM00179	EGF-like calcium-binding
	IPR006210	798	835	SM00181	EGF
	IPR000859	839	951	SM00042	CUB
	IPR000859	952	1068	SM00042	CUB
ProfileScan	IPR000859	414	526	PS01180	CUB
	IPR000859	527	639	PS01180	CUB
	IPR000742	639	680	PS50026	EGF-like
	IPR000859	683	795	PS01180	CUB
	IPR000742	795	835	PS50026	EGF-like
	IPR000859	839	951	PS01180	CUB
	IPR000859	952	1068	PS01180	CUB
ScanRegExp	IPR006025	302	311	PS00142	Peptidase M
	IPR001881	639	664	PS01187	EGF-like calcium-binding
	IPR000152	655	666	PS00010	Aspartic acid and asparagine hydroxylation site
	IPR013032	664	679	PS01186	EGF-like region
	IPR001881	795	819	PS01187	EGF-like calcium-binding
	IPR000152	810	821	PS00010	Aspartic acid and asparagine hydroxylation site
	IPR013032	819	834	PS01186	EGF-like region

Primer_f	ACTGGAACTGGGAAACCTAAG
Primer_r	AGTATCATTGTTTCACCGTCC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	ACTGGAACTGGGAAACCTAAG
Primer_r	AGTATCATTGTTTCACCGTCC
PCR product length	172 bp
PCR conditions	95 °C15 sec62 °C60 sec30 cycles