KIAA0938

Product ID	ORK06102
Accession No	AB023155
Description	neuron navigator 3
Clone name	hh04777s1
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (6268 bp) Predicted protein sequence (1257 aa)
Source	Human adult brain
Rouge ID	mKIAA0938 by Kazusa Mouse cDNA Project
Note	We replaced hh04777, former representative clones for KIAA0938 with hh04777s1. (2003/8/28)

Length: 6268 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	2493 bp
Genome contig ID	gi89161190f_76935955
PolyA signal sequence (ATTAAA,-24)	+--------+--------+----*----+---- ATTACTTTGCCATTAAAGTGGAATTATTTATTGAC
Flanking genome sequence (194966 - 195015)	----+--------+--------+--------+--------+----* AACATGGTGTGGTTTCTATTTATGGAAAAAAATGAATAATTTTGCATCAA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	12	f	77035955	77130919	24	99.6	Perfect prediction

Length: 1257 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAM73757	87.7	neuron navigato...	Homo sapiens
NP_055718	87.7	neuron navigato...	Homo sapiens
XP_509234	87.4	neuron navigato...	Pan troglodytes
BAG10403	88.0	neuron navigato...	synthetic construct
XP_001489298	85.1	neuron navigato...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB037840	6.5e-131	55.4	KIAA1419
AB032977	7.5e-56	42.7	KIAA1151
AB033039	1.2e-12	36.8	KIAA1213

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMSmart	IPR003593	920	1074	SM00382	AAA+ ATPase

Primer_f	TCAGTCATTGGAGAAGTTACC
Primer_r	GACCTATTGACTTTGTGACAC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	UniGene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-