Order Kazusa clone(s) from : ![]() |
Product ID | ORK07033 |
---|---|
Accession No | AB028977 |
Description | synaptic vesicle glycoprotein 2C |
Clone name | hh05240 |
Vector information | |
cDNA sequence | DNA sequence (5962 bp) Predicted protein sequence (480 aa) |
Source | Human adult brain |
Rouge ID |
mKIAA1054
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | Warning |
Length of 3'UTR | 4517 bp |
---|---|
Genome contig ID | gi51511721f_75441316 |
PolyA signal sequence (AGTAAA,-33) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (220331 - 220380) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 5 | f | 75526659 | 75661645 | 11 | 99.2 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR005828 | 1 | 114 | PF00083 | General substrate transporter |
IPR011701 | 330 | 447 | PF07690 | Major facilitator superfamily MFS_1 | |
HMMTigr | IPR005988 | 1 | 480 | TIGR01299 | Synaptic vesicle protein SV2 |
ProfileScan | IPR007114 | 1 | 475 | PS50850 | Major facilitator superfamily |
ScanRegExp | IPR005829 | 3 | 28 | PS00217 | Sugar transporter superfamily |
Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 2 | LLSGFGIGGAIPTVFSYFAEVLA | 24 | SECONDARY | 23 | 2 | 33 | SWLCMFWMIGGIYASAMAWAIIP | 55 | PRIMARY | 23 | 3 | 70 | HSWRVFVIVCALPCVSSVVALTF | 92 | PRIMARY | 23 | 4 | 334 | WIYFVNFLGTLAVLPGNIVSALL | 356 | PRIMARY | 23 | 5 | 362 | RLTMLGGSMVLSGISCFFLWFG | 383 | PRIMARY | 22 | 6 | 386 | ESMMIGMLCLYNGLTISAWNSLD | 408 | SECONDARY | 23 | 7 | 423 | GFGFLNALCKAAAVLGNLIFGSL | 445 | SECONDARY | 23 | 8 | 455 | LLASTVLVCGGLVGLCLPDTRTQ | 477 | PRIMARY | 23 |
---|
![]() |
Primer_f | GTCATTTCCAAAGCAGTCCAG |
---|---|
Primer_r | GAGCCTTTAGTGCATGAACAG |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | GeneBridge 4 |
---|---|
Primer_f | GTCATTTCCAAAGCAGTCCAG |
Primer_r | GAGCCTTTAGTGCATGAACAG |
PCR product length | 159 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |