Order Kazusa clone(s) from : ![]() |
Product ID | ORK05717 |
---|---|
Accession No | AB058715 |
Description | cadherin-related 23 |
Clone name | hh13045 |
Vector information | |
cDNA sequence | DNA sequence (5974 bp) Predicted protein sequence (803 aa) |
Source | Human adult brain |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 3560 bp |
---|---|
Genome contig ID | gi89161187f_72975679 |
PolyA signal sequence (None) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (170964 - 171013) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 10 | f | 73075679 | 73146641 | 17 | 99.9 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
FPrintScan | IPR002126 | 51 | 80 | PR00205 | Cadherin |
IPR002126 | 119 | 131 | PR00205 | Cadherin | |
IPR002126 | 241 | 260 | PR00205 | Cadherin | |
IPR002126 | 260 | 273 | PR00205 | Cadherin | |
IPR002126 | 534 | 560 | PR00205 | Cadherin | |
IPR002126 | 675 | 692 | PR00205 | Cadherin | |
HMMPfam | IPR002126 | 56 | 143 | PF00028 | Cadherin |
IPR002126 | 157 | 253 | PF00028 | Cadherin | |
IPR002126 | 267 | 360 | PF00028 | Cadherin | |
IPR002126 | 374 | 470 | PF00028 | Cadherin | |
IPR002126 | 486 | 577 | PF00028 | Cadherin | |
IPR002126 | 591 | 682 | PF00028 | Cadherin | |
HMMSmart | IPR002126 | 73 | 150 | SM00112 | Cadherin |
IPR002126 | 174 | 260 | SM00112 | Cadherin | |
IPR002126 | 284 | 367 | SM00112 | Cadherin | |
IPR002126 | 391 | 479 | SM00112 | Cadherin | |
IPR002126 | 503 | 584 | SM00112 | Cadherin | |
IPR002126 | 608 | 691 | SM00112 | Cadherin | |
ProfileScan | IPR002126 | 4 | 51 | PS50268 | Cadherin |
IPR002126 | 52 | 152 | PS50268 | Cadherin | |
IPR002126 | 153 | 262 | PS50268 | Cadherin | |
IPR002126 | 263 | 375 | PS50268 | Cadherin | |
IPR002126 | 370 | 481 | PS50268 | Cadherin | |
IPR002126 | 482 | 586 | PS50268 | Cadherin | |
IPR002126 | 587 | 693 | PS50268 | Cadherin | |
ScanRegExp | IPR002126 | 140 | 150 | PS00232 | Cadherin |
IPR002126 | 250 | 260 | PS00232 | Cadherin | |
IPR002126 | 357 | 367 | PS00232 | Cadherin | |
IPR002126 | 469 | 479 | PS00232 | Cadherin | |
IPR002126 | 681 | 691 | PS00232 | Cadherin |
![]() |
Primer_f | CTCACCAAAACCACAGATAGC |
---|---|
Primer_r | CAAGAGGCAGGGCATTTCCAG |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | GeneBridge 4 |
---|---|
Primer_f | CTCACCAAAACCACAGATAGC |
Primer_r | CAAGAGGCAGGGCATTTCCAG |
PCR product length | 95 bp |
PCR conditions | 15 °C![]() ![]() ![]() ![]() |