KIAA1256

Product ID	ORK00207
Accession No	AB033082
Description	intersectin 2, transcript variant 3
Clone name	hh15293
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5938 bp) Predicted protein sequence (1676 aa)
HaloTag ORF Clone	FHC00207
Flexi ORF Clone	FXC00207
Source	Human adult brain
Rouge ID	mKIAA1256 by Kazusa Mouse cDNA Project

Length: 5938 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	760 bp
Genome contig ID	gi89161199r_24179239
PolyA signal sequence (AATAAA,-25)	+--------+--------+----*----+---- ACAGAAAGAGAATAAAGACATATGTTTATGGATGG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AACTTCGTCAAAGTCTGACTGATTTACTTTCTATATGAAAGCTGCTTTTT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	2	r	24279239	24436808	39	100.0	Perfect prediction

Length: 1676 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAF63600	100.0	intersectin 2 [...	Homo sapiens
BAG10443	100.0	intersectin-2 [...	synthetic construct
EAX00753	99.9	intersectin 2, ...	Homo sapiens
AAI46780	100.0	Intersectin 2 [...	Homo sapiens
XP_532890	94.4	similar to inte...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB002380	2.2e-05	28.6	KIAA0382
AB002378	9.9e-05	26.5	KIAA0380
D63476	0.00063	24.5	KIAA0142
AB029035	0.00093	23.4	KIAA1112

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR002048	255	312	PD000012	Calcium-binding EF-hand
	IPR001452	741	793	PD000066	Src homology-3
	IPR001452	881	930	PD000066	Src homology-3
	IPR001452	965	1013	PD000066	Src homology-3
	IPR001452	1043	1091	PD000066	Src homology-3
	IPR001452	1110	1160	PD000066	Src homology-3
FPrintScan	IPR000108	1050	1069	PR00499	Neutrophil cytosol factor 2
	IPR001452	1109	1119	PR00452	Src homology-3
	IPR000108	1111	1131	PR00499	Neutrophil cytosol factor 2
	IPR001452	1123	1138	PR00452	Src homology-3
	IPR000108	1131	1147	PR00499	Neutrophil cytosol factor 2
	IPR001452	1140	1149	PR00452	Src homology-3
	IPR000108	1147	1160	PR00499	Neutrophil cytosol factor 2
	IPR001452	1151	1163	PR00452	Src homology-3
	IPR000008	1565	1577	PR00360	C2 calcium-dependent membrane targeting
	IPR000008	1589	1602	PR00360	C2 calcium-dependent membrane targeting
HMMPfam	IPR002048	64	92	PF00036	Calcium-binding EF-hand
	IPR002048	287	315	PF00036	Calcium-binding EF-hand
	IPR001452	741	795	PF00018	Src homology-3
	IPR011511	881	933	PF07653	Variant SH3
	IPR001452	963	1016	PF00018	Src homology-3
	IPR001452	1035	1094	PF00018	Src homology-3
	IPR001452	1109	1163	PF00018	Src homology-3
	IPR000219	1192	1373	PF00621	DH
	IPR001849	1414	1523	PF00169	Pleckstrin-like
	IPR000008	1550	1631	PF00168	C2 calcium-dependent membrane targeting
HMMSmart	IPR000261	21	115	SM00027	EPS15 homology (EH)
	IPR002048	64	92	SM00054	Calcium-binding EF-hand
	IPR000261	243	338	SM00027	EPS15 homology (EH)
	IPR002048	287	315	SM00054	Calcium-binding EF-hand
	IPR001452	739	796	SM00326	Src homology-3
	IPR001452	880	934	SM00326	Src homology-3
	IPR001452	963	1017	SM00326	Src homology-3
	IPR001452	1035	1095	SM00326	Src homology-3
	IPR001452	1109	1164	SM00326	Src homology-3
	IPR000219	1192	1373	SM00325	DH
	IPR001849	1414	1525	SM00233	Pleckstrin-like
	IPR000008	1549	1646	SM00239	C2 calcium-dependent membrane targeting
ProfileScan	IPR000261	28	116	PS50031	EPS15 homology (EH)
	IPR002048	60	95	PS50222	Calcium-binding EF-hand
	IPR000261	250	339	PS50031	EPS15 homology (EH)
	IPR002048	283	318	PS50222	Calcium-binding EF-hand
	IPR001452	736	797	PS50002	Src homology-3
	IPR001452	877	935	PS50002	Src homology-3
	IPR001452	960	1018	PS50002	Src homology-3
	IPR001452	1032	1096	PS50002	Src homology-3
	IPR001452	1106	1165	PS50002	Src homology-3
	IPR000219	1188	1374	PS50010	DH
	IPR001849	1413	1523	PS50003	Pleckstrin-like
	IPR000008	1549	1631	PS50004	C2 calcium-dependent membrane targeting
ScanRegExp	IPR002048	73	85	PS00018	Calcium-binding EF-hand

Primer_f	CCCTCCGAACAGACAACATTA
Primer_r	GTAGCTTCAATGACATGCACC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	unigene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-