Order Kazusa clone(s) from : ![]() |
Product ID | ORK05647 |
---|---|
Accession No | AB033088 |
Description | spectrin repeat containing, nuclear envelope 1 |
Clone name | hh15990 |
Vector information | |
cDNA sequence | DNA sequence (5683 bp) Predicted protein sequence (1362 aa) |
Source | Human adult brain |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 1594 bp |
---|---|
Genome contig ID | gi89161210r_152578328 |
PolyA signal sequence (None) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (99722 - 99673) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 6 | r | 152678050 | 152696975 | 11 | 98.9 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR002017 | 128 | 232 | PF00435 | Spectrin repeat |
IPR002017 | 235 | 341 | PF00435 | Spectrin repeat | |
IPR002017 | 453 | 557 | PF00435 | Spectrin repeat | |
IPR002017 | 666 | 772 | PF00435 | Spectrin repeat | |
IPR002017 | 883 | 990 | PF00435 | Spectrin repeat | |
HMMSmart | IPR002017 | 129 | 231 | SM00150 | Spectrin repeat |
IPR002017 | 238 | 340 | SM00150 | Spectrin repeat | |
IPR002017 | 347 | 449 | SM00150 | Spectrin repeat | |
IPR002017 | 456 | 556 | SM00150 | Spectrin repeat | |
IPR002017 | 669 | 771 | SM00150 | Spectrin repeat | |
IPR002017 | 778 | 879 | SM00150 | Spectrin repeat | |
IPR002017 | 886 | 989 | SM00150 | Spectrin repeat | |
IPR002017 | 996 | 1101 | SM00150 | Spectrin repeat | |
IPR002017 | 1210 | 1305 | SM00150 | Spectrin repeat |
![]() |
Primer_f | CAGAGCAAGCCATGAGTCCAC |
---|---|
Primer_r | CGTGACTGACAGAAAAGGAAC |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | GeneBridge 4 |
---|---|
Primer_f | CAGAGCAAGCCATGAGTCCAC |
Primer_r | CGTGACTGACAGAAAAGGAAC |
PCR product length | 94 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |