Order Kazusa clone(s) from :
Japan
||
Other countries |
Product ID | ORK00077 |
---|---|
Accession No | AB007899 |
Description | neural precursor cell expressed, developmentally down-regulated 4-like, E3 ubiquitin protein ligase, transcript variant c |
Clone name | hj00462 |
Vector information | |
cDNA sequence | DNA sequence (4879 bp) Predicted protein sequence (995 aa) |
HaloTag ORF Clone |
FHC00077
|
Flexi ORF Clone | FXC00077 |
Source | Human adult brain |
Rouge ID |
mKIAA0439
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.Result of homology search against HUGE database (FASTA output, Multiple alignment)
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
FPrintScan | IPR000008 | 77 | 89 | PR00360 | C2 calcium-dependent membrane targeting |
IPR000008 | 108 | 121 | PR00360 | C2 calcium-dependent membrane targeting | |
HMMPfam | IPR000008 | 79 | 149 | PF00168 | C2 calcium-dependent membrane targeting |
IPR001202 | 235 | 264 | PF00397 | WW/Rsp5/WWP | |
IPR001202 | 407 | 436 | PF00397 | WW/Rsp5/WWP | |
IPR001202 | 519 | 548 | PF00397 | WW/Rsp5/WWP | |
IPR001202 | 570 | 599 | PF00397 | WW/Rsp5/WWP | |
IPR000569 | 689 | 994 | PF00632 | HECT | |
HMMSmart | IPR000008 | 53 | 164 | SM00239 | C2 calcium-dependent membrane targeting |
IPR001202 | 234 | 266 | SM00456 | WW/Rsp5/WWP | |
IPR001202 | 406 | 438 | SM00456 | WW/Rsp5/WWP | |
IPR001202 | 518 | 550 | SM00456 | WW/Rsp5/WWP | |
IPR001202 | 569 | 601 | SM00456 | WW/Rsp5/WWP | |
IPR000569 | 658 | 994 | SM00119 | HECT | |
ProfileScan | IPR000008 | 69 | 149 | PS50004 | C2 calcium-dependent membrane targeting |
IPR001202 | 233 | 266 | PS50020 | WW/Rsp5/WWP | |
IPR001202 | 405 | 438 | PS50020 | WW/Rsp5/WWP | |
IPR001202 | 517 | 550 | PS50020 | WW/Rsp5/WWP | |
IPR001202 | 568 | 601 | PS50020 | WW/Rsp5/WWP | |
IPR000569 | 660 | 994 | PS50237 | HECT | |
ScanRegExp | IPR001202 | 239 | 264 | PS01159 | WW/Rsp5/WWP |
IPR001202 | 411 | 436 | PS01159 | WW/Rsp5/WWP | |
IPR001202 | 523 | 548 | PS01159 | WW/Rsp5/WWP | |
IPR001202 | 574 | 599 | PS01159 | WW/Rsp5/WWP |
RT-PCR |
---|
Primer_f | GGTCGTTCAACTCCCACACTG |
---|---|
Primer_r | ACTTGACTTGATCCTCTGAGC |
PCR conditions | 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles |
Panel name | GeneBridge 4 |
---|---|
Primer_f | GGTCGTTCAACTCCCACACTG |
Primer_r | ACTTGACTTGATCCTCTGAGC |
PCR product length | 159 bp |
PCR conditions | 95 °C15 sec64 °C60 sec30 cycles |