Order Kazusa clone(s) from :
Japan
||
Other countries |
Product ID | ORK05236 |
---|---|
Accession No | AB028984 |
Description | follistatin-like 4 |
Clone name | hj00491 |
Vector information | |
cDNA sequence | DNA sequence (4719 bp) Predicted protein sequence (693 aa) |
Source | Human adult brain |
Rouge ID |
mKIAA1061
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 2635 bp |
---|---|
Genome contig ID | gi51511721r_132460051 |
PolyA signal sequence (AATAAA,-17) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 5 | r | 132560051 | 132680207 | 12 | 99.3 | Perfect prediction |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.Result of homology search against HUGE database (FASTA output, Multiple alignment)
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR013151 | 114 | 174 | PF00047 | Immunoglobulin |
IPR013098 | 192 | 281 | PF07679 | Immunoglobulin I-set | |
HMMSmart | IPR003599 | 106 | 189 | SM00409 | Immunoglobulin subtype |
IPR003598 | 112 | 179 | SM00408 | Immunoglobulin subtype 2 | |
IPR003599 | 198 | 282 | SM00409 | Immunoglobulin subtype | |
IPR003598 | 204 | 271 | SM00408 | Immunoglobulin subtype 2 | |
ProfileScan | IPR002048 | 25 | 60 | PS50222 | Calcium-binding EF-hand |
IPR007110 | 102 | 189 | PS50835 | Immunoglobulin-like | |
IPR007110 | 192 | 277 | PS50835 | Immunoglobulin-like | |
IPR007110 | 659 | 693 | PS50835 | Immunoglobulin-like | |
ScanRegExp | IPR002048 | 38 | 50 | PS00018 | Calcium-binding EF-hand |
RT-PCR-ELISA |
Primer_f | CAGCAGAGGTTCATGGGACAC |
---|---|
Primer_r | CATTAGGAGGATTACCGGCTG |
PCR conditions | 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles |
Panel name | GeneBridge 4 |
---|---|
Primer_f | CAGCAGAGGTTCATGGGACAC |
Primer_r | CATTAGGAGGATTACCGGCTG |
PCR product length | 100 bp |
PCR conditions | 95 °C15 sec66 °C60 sec30 cycles |