Gene/Protein Characteristic Table for KIAA0590
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK00104
Accession No AB011162
Description intraflagellar transport 140
Clone name hj02755
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (4962 bp)
Predicted protein sequence (1468 aa)
Source Human adult brain
Rouge ID mKIAA0590 by Kazusa Mouse cDNA Project
Features of the cloned cDNA sequence
Description

Length: 4962 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq No warning No warning
Features of the protein sequence
Description

Length: 1468 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAG10359 0 100.0 intraflagellar ...
synthetic construct
XP_001497463 0 84.2 similar to intr...
Equus caballus
NP_598887 0 81.5 intraflagellar ...
Mus musculus
AAI39006 0 81.4 Intraflagellar ...
Mus musculus
ABB72790 0 81.2 intraflagellar ...
Mus musculus
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
Entry Exp ID% HUGE_ID
AB033005 0.00012 23.1 KIAA1179
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR001680 99 137 PF00400 WD40 repeat
HMMSmart IPR001680 61 95 SM00320 WD40 repeat
IPR001680 97 137 SM00320 WD40 repeat
IPR001680 320 358 SM00320 WD40 repeat
ProfileScan IPR001680 63 146 PS50294 WD40 repeat
IPR001680 105 146 PS50082 WD40 repeat
Expression profile
Description

RT-PCR
Experimental conditions
Primer_f CATGTCTGTGTTGGAATACGC
Primer_r GAATACGATGGAAGGGTGAAC
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information
Description

Chromosome No. 16
Experimental conditions
Panel name GeneBridge 4
Primer_f CATGTCTGTGTTGGAATACGC
Primer_r GAATACGATGGAAGGGTGAAC
PCR product length 178 bp
PCR conditions 95 °C15 sec62 °C60 sec30 cycles
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp