KIAA0560

Product ID	ORK00096
Accession No	AB011132
Description	aquarius intron-binding spliceosomal factor
Clone name	hj07625
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5070 bp) Predicted protein sequence (1521 aa)
HaloTag ORF Clone	FHC00096
Flexi ORF Clone	FXC00096
Source	Human adult brain
Rouge ID	mKIAA0560 by Kazusa Mouse cDNA Project
Note	We replaced hh01648, former representative clones for KIAA0560 with hj07625. (1999/12/25)

Length: 5070 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	503 bp
Genome contig ID	gi51511731r_32835782
PolyA signal sequence (None)	+--------+--------+----*----+---- TATTATTAGCAGTAAGATACAGGTTTCTTCAATCT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ATCAAAGTGGTTACATGCATTTCCTTCTCTCAAATCTTAGAATGCCTTAG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	15	r	32935782	33049215	35	99.8	Perfect prediction

Length: 1521 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_510286	99.9	aquarius [Pan t...	Pan troglodytes
O60306	100.0	Intron-binding ...	Homo sapiens
BAF84304	99.9	unnamed protein...	Homo sapiens
ABQ66265	99.9	AQR [Homo sapiens].	Homo sapiens
XP_001089350	96.5	similar to aqua...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
D86988	9.2e-12	24.2	KIAA0221
AB014525	1.8e-09	21.7	KIAA0625
AB037825	2.1e-07	32.5	KIAA1404

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.