KIAA0987

Product ID	ORK01141
Accession No	AB023204
Description	erythrocyte membrane protein band 4.1-like 3, transcript variant 1
Clone name	hk01713
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4446 bp) Predicted protein sequence (1115 aa)
HaloTag ORF Clone	FHC01141
Flexi ORF Clone	FXC01141
Source	Human adult brain
Rouge ID	mKIAA0987 by Kazusa Mouse cDNA Project

Length: 4446 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	1096 bp
Genome contig ID	gi51511735r_5282388
PolyA signal sequence (AATAAA,-22)	+--------+--------+----*----+---- TTCTGCATAGCGAAATAAAAATGGCAAATGCACTG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAGCTCTAAGTTTGTATGTTTAATAATTTCAGTATTGTATGTGTTTAGT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	18	r	5382388	5533986	23	100.0	Perfect prediction

Length: 1115 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q9Y2J2	100.0	Band 4.1-like p...	Homo sapiens
CAH92695	98.8	hypothetical pr...	Pongo abelii
XP_512036	98.9	erythrocyte mem...	Pan troglodytes
XP_870774	89.2	similar to Band...	Bos taurus
XP_001914904	90.6	similar to Band...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB002336	5.5e-82	43.2	KIAA0338
AB018336	1.4e-31	35.7	KIAA0793
AB046768	6.8e-15	39.8	KIAA1548

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR000798	151	170	PR00661	Ezrin/radixin/moesin ERM
	IPR000299	171	183	PR00935	Band 4.1
	IPR000798	201	220	PR00661	Ezrin/radixin/moesin ERM
	IPR000299	235	248	PR00935	Band 4.1
	IPR000798	244	265	PR00661	Ezrin/radixin/moesin ERM
	IPR000299	248	268	PR00935	Band 4.1
	IPR000299	309	325	PR00935	Band 4.1
	IPR000798	332	352	PR00661	Ezrin/radixin/moesin ERM
HMMPfam	IPR000299	140	329	PF00373	Band 4.1
	IPR014847	423	471	PF08736	FERM adjacent (FA)
	IPR007477	726	793	PF04382	SAB
	IPR008379	995	1108	PF05902	Band 4.1
HMMSmart	IPR000299	134	329	SM00295	Band 4.1
ProfileScan	IPR000299	138	419	PS50057	Band 4.1
ScanRegExp	IPR000299	192	220	PS00660	Band 4.1
ScanRegExp	IPR000299	299	328	PS00661	Band 4.1

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	664	FLFIFFFLLSASFSVPYALTLSF	686	PRIMARY	23

Primer_f	GAGCCAAGCCTTAAACTGTAC
Primer_r	ATGCAGGTGATCGTGTAATGG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	UniGene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-