Order Kazusa clone(s) from : ![]() |
Product ID | ORK00618 |
---|---|
Accession No | AB018279 |
Description | synaptic vesicle glycoprotein 2A, transcript variant 1 |
Clone name | hk03846 |
Vector information | |
cDNA sequence | DNA sequence (4353 bp) Predicted protein sequence (748 aa) |
HaloTag ORF Clone |
FHC00618
![]() |
Flexi ORF Clone | FXC00618 |
Source | Human adult brain |
Rouge ID |
mKIAA0736
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 1690 bp |
---|---|
Genome contig ID | gi89161185r_148041558 |
PolyA signal sequence (AATAAA,-27) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (99942 - 99893) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 1 | r | 148141500 | 148156001 | 13 | 99.8 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR011701 | 178 | 715 | PF07690 | Major facilitator superfamily MFS_1 |
HMMTigr | IPR005988 | 7 | 748 | TIGR01299 | Synaptic vesicle protein SV2 |
ProfileScan | IPR007114 | 174 | 743 | PS50850 | Major facilitator superfamily |
ScanRegExp | IPR005829 | 270 | 295 | PS00217 | Sugar transporter superfamily |
Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 174 | LYFVLGLALMADGVEVFVVGFVL | 196 | PRIMARY | 23 | 2 | 211 | GMLGLIVYLGMMVGAFLWGGLAD | 233 | PRIMARY | 23 | 3 | 239 | QCLLISLSVNSVFAFFSSFVQGY | 261 | SECONDARY | 23 | 4 | 266 | FCRLLSGVGIGGSIPIVFSYFSE | 288 | PRIMARY | 23 | 5 | 301 | WLCMFWMIGGVYAAAMAWAIIPH | 323 | SECONDARY | 23 | 6 | 337 | HSWRVFVLVCAFPSVFAIGALTT | 359 | PRIMARY | 23 | 7 | 602 | MVYFVSFLGTLAVLPGNIVSALL | 624 | PRIMARY | 23 | 8 | 632 | RMLAGSSVMSCVSCFFLSF | 650 | SECONDARY | 19 | 9 | 659 | ALLCLFGGVSIASWNALDVLTVE | 681 | SECONDARY | 23 | 10 | 691 | AFGFLNALCKLAAVLGISIFTSF | 713 | SECONDARY | 23 | 11 | 723 | LFASAALALGSSLALKLPETRGQ | 745 | SECONDARY | 23 |
---|
![]() |
Primer_f | ATTCACCTTCGTCATGCTGCG |
---|---|
Primer_r | ACACTCATACACTGGGCACTG |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | GeneBridge 4 |
---|---|
Primer_f | ATTCACCTTCGTCATGCTGCG |
Primer_r | ACACTCATACACTGGGCACTG |
PCR product length | 119 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |