KIAA1092

Product ID	ORK00737
Accession No	AB029015
Description	phospholipase C-like 2, transcript variant 1
Clone name	hk04417
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4147 bp) Predicted protein sequence (1154 aa)
HaloTag ORF Clone	FHC00737
Flexi ORF Clone	FXC00737
Source	Human adult brain
Rouge ID	mKIAA1092 by Kazusa Mouse cDNA Project

Length: 4147 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	682 bp
Genome contig ID	gi89161205f_16801567
PolyA signal sequence (ATTAAA,-21)	+--------+--------+----*----+---- GAAGTAGTGTTCACATTAAAAAGATGTTTTATGAT
Flanking genome sequence (305525 - 305574)	----+--------+--------+--------+--------+----* ATTTCTCCAATAGCAGTACATGTGTTTAATGAAGCCTTAACTTTTAAGAT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	3	f	16901456	17107090	6	99.6	Perfect prediction

Length: 1154 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_526146	100.0	phospholipase C...	Pan troglodytes
Q9UPR0	100.0	Inactive phosph...	Homo sapiens
AAH27746	96.7	Plcl2 protein [...	Mus musculus
Q8K394	96.6	Inactive phosph...	Mus musculus
BAE32490	96.5	unnamed protein...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB075844	1.3e-56	37.2	KIAA1964
AB007919	3e-48	37.0	KIAA0450
AB028992	4.6e-29	37.3	KIAA1069
AB040949	6.8e-19	28.0	KIAA1516
AB011153	3.7e-18	31.6	KIAA0581

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR013841	464	749	PD001202	Phosphatidylinositol-specific phospholipase C
FPrintScan	IPR001192	458	476	PR00390	Phosphoinositide-specific phospholipase C
	IPR001192	484	504	PR00390	Phosphoinositide-specific phospholipase C
	IPR001192	581	598	PR00390	Phosphoinositide-specific phospholipase C
	IPR001192	699	720	PR00390	Phosphoinositide-specific phospholipase C
	IPR001192	720	738	PR00390	Phosphoinositide-specific phospholipase C
	IPR000008	802	814	PR00360	C2 calcium-dependent membrane targeting
	IPR000008	832	845	PR00360	C2 calcium-dependent membrane targeting
	IPR001192	874	884	PR00390	Phosphoinositide-specific phospholipase C
HMMPfam	IPR001849	169	278	PF00169	Pleckstrin-like
	IPR015359	370	452	PF09279	EF-hand-like
	IPR000909	454	598	PF00388	Phosphatidylinositol-specific phospholipase C
	IPR001711	644	761	PF00387	Phosphatidylinositol-specific phospholipase C
	IPR000008	783	873	PF00168	C2 calcium-dependent membrane targeting
HMMSmart	IPR001849	169	280	SM00233	Pleckstrin-like
	IPR000909	453	597	SM00148	Phosphatidylinositol-specific phospholipase C
	IPR001711	645	761	SM00149	Phosphatidylinositol-specific phospholipase C
	IPR000008	782	888	SM00239	C2 calcium-dependent membrane targeting
ProfileScan	IPR001849	168	278	PS50003	Pleckstrin-like
	IPR000909	453	597	PS50007	Phosphatidylinositol-specific phospholipase C
	IPR001711	645	761	PS50008	Phosphatidylinositol-specific phospholipase C
	IPR000008	768	873	PS50004	C2 calcium-dependent membrane targeting

Primer_f	CCCAATAATGTGCCTGTGAAG
Primer_r	TTTCATTGGCGTACTTGCTGG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	AAGAGAATGTAAGTGGACGGG
Primer_r	ATGTATCTTCAGCCAGGGAGC
PCR product length	101 bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles