KIAA0782

Product ID	ORK00637
Accession No	AB018325
Description	ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 1, transcript variant 1
Clone name	hk05405s1
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4919 bp) Predicted protein sequence (1281 aa)
HaloTag ORF Clone	FHC00637
Flexi ORF Clone	FXC00637
Source	Human adult brain
Rouge ID	mKIAA0782 by Kazusa Mouse cDNA Project
Note	We replaced hk05405, former representative clones for KIAA0782 with hk05405s1. (2002/5/10)

Length: 4919 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	589 bp
Genome contig ID	gi51511727r_71973768
PolyA signal sequence (TATAAA,-22)	+--------+--------+----*----+---- GACTTTTTGATAATATAAATATATCTGTATATTTT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ACCCTATGGTGCTGAGGCCTGTGATTGGCTAAGGGGATTGGGCGTCCTGG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	11	r	72073768	72111028	33	99.9	Perfect prediction

Length: 1281 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAT36325	100.0	ARAP1b protein ...	Homo sapiens
XP_508625	99.6	centaurin delta...	Pan troglodytes
XP_001114962	98.0	similar to cent...	Macaca mulatta
EAW74863	98.9	centaurin, delt...	Homo sapiens
BAG09846	100.0	centaurin-delta...	synthetic construct

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB011152	2.5e-68	41.7	KIAA0580
AB040934	6.7e-05	25.7	KIAA1501
D79989	8.2e-05	30.2	KIAA0167
AB051509	0.00013	36.2	KIAA1722
AB014521	0.00031	29.3	KIAA0621

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR001164	378	397	PR00405	Arf GTPase activating protein
	IPR001164	397	414	PR00405	Arf GTPase activating protein
	IPR001164	420	441	PR00405	Arf GTPase activating protein
HMMPfam	IPR001849	159	250	PF00169	Pleckstrin-like
	IPR001164	366	490	PF01412	Arf GTPase activating protein
	IPR001849	575	681	PF00169	Pleckstrin-like
	IPR000198	802	951	PF00620	RhoGAP
	IPR000159	1003	1092	PF00788	Ras-association
	IPR001849	1106	1227	PF00169	Pleckstrin-like
HMMSmart	IPR001849	159	252	SM00233	Pleckstrin-like
	IPR001849	272	362	SM00233	Pleckstrin-like
	IPR001164	366	492	SM00105	Arf GTPase activating protein
	IPR001849	575	683	SM00233	Pleckstrin-like
	IPR001849	693	787	SM00233	Pleckstrin-like
	IPR000198	799	975	SM00324	RhoGAP
	IPR001849	1106	1229	SM00233	Pleckstrin-like
ProfileScan	IPR001849	158	250	PS50003	Pleckstrin-like
	IPR001849	271	360	PS50003	Pleckstrin-like
	IPR001164	366	491	PS50115	Arf GTPase activating protein
	IPR001849	574	681	PS50003	Pleckstrin-like
	IPR000198	785	970	PS50238	RhoGAP
	IPR000159	1003	1092	PS50200	Ras-association
	IPR001849	1105	1227	PS50003	Pleckstrin-like

Primer_f	CTGGAGAGATGGGCATAAGTC
Primer_r	GCTGTTCTGGAGTTTGTTGGG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	CTGGAGAGATGGGCATAAGTC
Primer_r	GCTGTTCTGGAGTTTGTTGGG
PCR product length	118 bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles