KIAA1437

Product ID	ORK00834
Accession No	AB037858
Description	leucine rich repeat containing 8 family, member A, transcript variant 2
Clone name	hk07206
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector. This cDNA clone hk07206 has an irregular adapter sequence (GTCGACCCAC GCGTCCGCGG ACGCGTGGG) instead of regular one (GTCGACCCAC GCGTCCG).
cDNA sequence	DNA sequence (4161 bp) Predicted protein sequence (811 aa)
HaloTag ORF Clone	FHC00834
Flexi ORF Clone	FXC00834
Source	Human adult brain
Rouge ID	mKIAA1437 by Kazusa Mouse cDNA Project

Length: 4161 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	1665 bp
Genome contig ID	gi89161216f_130584296
PolyA signal sequence (AATAAA,-17)	+--------+--------+----*----+---- GACTCGGTCACAGTATCAAATAAAATCTATAACAG
Flanking genome sequence (135842 - 135891)	----+--------+--------+--------+--------+----* AAAGTGGCCTTTGGAGGTCTTTGTGTCATGGGAGGACGCTTCCCTCACTT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	9	f	130684296	130720136	3	99.0	Perfect prediction

Length: 811 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q8IWT6	100.0	Leucine-rich re...	Homo sapiens
ABY84167	99.9	leucine-rich re...	Callithrix jacchus
BAF82531	99.8	unnamed protein...	Homo sapiens
XP_001500311	99.4	similar to Leuc...	Equus caballus
AAI23433	99.0	Leucine rich re...	Bos taurus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
D86984	2.3e-175	59.0	KIAA0231
D63481	4e-14	30.6	KIAA0147
AB020669	3.8e-13	28.9	KIAA0862
AB033051	1.3e-11	28.1	KIAA1225
AB023233	1.9e-09	30.4	KIAA1016

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR001611	688	701	PR00019	Leucine-rich repeat
FPrintScan	IPR001611	754	767	PR00019	Leucine-rich repeat
HMMPfam	IPR001611	593	614	PF00560	Leucine-rich repeat
	IPR001611	616	636	PF00560	Leucine-rich repeat
	IPR001611	641	662	PF00560	Leucine-rich repeat
	IPR001611	664	685	PF00560	Leucine-rich repeat
	IPR001611	687	708	PF00560	Leucine-rich repeat
	IPR001611	710	731	PF00560	Leucine-rich repeat
	IPR001611	733	754	PF00560	Leucine-rich repeat
	IPR001611	756	777	PF00560	Leucine-rich repeat
HMMSmart	IPR003591	591	614	SM00369	Leucine-rich repeat
	NULL	614	635	SM00365	NULL
	IPR003591	615	637	SM00369	Leucine-rich repeat
	IPR003591	639	661	SM00369	Leucine-rich repeat
	NULL	662	693	SM00365	NULL
	IPR003591	662	685	SM00369	Leucine-rich repeat
	IPR003591	686	707	SM00369	Leucine-rich repeat
	IPR003591	708	731	SM00369	Leucine-rich repeat
	IPR003591	732	752	SM00369	Leucine-rich repeat
	NULL	754	774	SM00365	NULL
	IPR003591	754	777	SM00369	Leucine-rich repeat

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	26	DVFTDYISIVMLMIAVFGGTLQV	48	SECONDARY	23
	2	266	MRQTIIKVIKFILIICYTVYYVH	288	PRIMARY	23
	3	319	FKILASFYISLVIFYGLICMYTL	341	PRIMARY	23

Primer_f	TCCCCGCCTTAGATCAATCAC
Primer_r	GGTTGTCAGAGGCTAGTGTGC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	unigene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-