Order Kazusa clone(s) from : ![]() |
Product ID | ORK01130 |
---|---|
Accession No | AB020689 |
Description | TBC1 domain family, member 9 (with GRAM domain) |
Clone name | hk07544s1 |
Vector information | |
cDNA sequence | DNA sequence (5286 bp) Predicted protein sequence (1291 aa) |
HaloTag ORF Clone |
FHC01130
![]() |
Flexi ORF Clone | FXC01130 |
Source | Human adult brain |
Rouge ID |
mKIAA0882
by Kazusa Mouse cDNA Project
|
Note | We replaced hk07544, former representative clones for KIAA0882 with hk07544s1. (2002/5/10) |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 1410 bp |
---|---|
Genome contig ID | gi89161207r_141661389 |
PolyA signal sequence (AATAAA,-21) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 4 | r | 141761389 | 141896724 | 21 | 99.6 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR004182 | 171 | 238 | PF02893 | GRAM |
IPR004182 | 318 | 386 | PF02893 | GRAM | |
IPR000195 | 537 | 749 | PF00566 | RabGAP/TBC | |
IPR002048 | 915 | 943 | PF00036 | Calcium-binding EF-hand | |
HMMSmart | IPR004182 | 171 | 238 | SM00568 | GRAM |
IPR004182 | 318 | 386 | SM00568 | GRAM | |
IPR000195 | 537 | 750 | SM00164 | RabGAP/TBC | |
ProfileScan | IPR000195 | 540 | 727 | PS50086 | RabGAP/TBC |
IPR002048 | 911 | 946 | PS50222 | Calcium-binding EF-hand |
Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 696 | STISLSWFLTLFLSVMPFESAVV | 718 | PRIMARY | 23 |
---|
![]() |
Primer_f | AAGTAGCAGCAAAGACAGAGG |
---|---|
Primer_r | ATCCAGTATCAGAAGCATCAG |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | GeneBridge 4 |
---|---|
Primer_f | AAGTAGCAGCAAAGACAGAGG |
Primer_r | ATCCAGTATCAGAAGCATCAG |
PCR product length | 97 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |