HUGE

Gene/Protein Characteristic Table for KIAA0472

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Mapping

Product ID :	ORK06659
Accession No. :	AB007941
Description :	Receptor-interacting serine/threonine-protein kinase 5.
HUGO Gene Name :	receptor interacting protein kinase 5 (RIPK5)
Clone Name :	hh00171 [Vector Info]
Flexi ORF Clone :	pF1KA0472
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 5494 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 4394 bp

Genome contig ID gi89161185r_203279136
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
ACTCCAGCCTGGGCAGCAGAGCAAGACTCCATCTC
Flanking genome sequence
(99780 - 99731)
----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAAAAAGAAAAAGAAAAAGAAGGTTAATCCTTCAGTTATGGA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 1 r 203378916 203397914 8 99.1 Perfect prediction

Features of the protein sequence	Description

Length: 365 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q6XUX3	2.7e-152	100.0	Receptor-intera...	Homo sapiens
AAH72406	2.7e-152	100.0	Receptor intera...	Homo sapiens
Q4VSN5	5.6e-152	99.7	Receptor-intera...	Pan troglodytes
ABD72471	1e-151	99.5	dusty protein k...	Macaca mulatta
NP_001035038	1e-151	99.5	receptor intera...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB051547	5.9e-09	25.2	KIAA1760
AB033090	8.9e-09	30.5	KIAA1264
AB032968	1.1e-08	28.1	KIAA1142
AB037782	1.3e-08	28.0	KIAA1361
AB033104	1.5e-08	27.3	KIAA1278

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

BlastProDom IPR000719 153 333 PD000001 Protein kinase

HMMPfam IPR000719 88 333 PF00069 Protein kinase

HMMSmart IPR001245 88 342 SM00219 Tyrosine protein kinase

IPR002290 88 342 SM00220 Serine/threonine protein kinase

ProfileScan IPR000719 88 342 PS50011 Protein kinase

ScanRegExp IPR000719 94 117 PS00107 Protein kinase

IPR008271 209 221 PS00108 Serine/threonine protein kinase

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR000719	153	333	PD000001	Protein kinase
HMMPfam	IPR000719	88	333	PF00069	Protein kinase
HMMSmart	IPR001245	88	342	SM00219	Tyrosine protein kinase
IPR002290	88	342	SM00220	Serine/threonine protein kinase
ProfileScan	IPR000719	88	342	PS50011	Protein kinase
ScanRegExp	IPR000719	94	117	PS00107	Protein kinase
IPR008271	209	221	PS00108	Serine/threonine protein kinase

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

SOSUI2 1 262 DNSVDVYAFGILFWYICSGSVKL 284 PRIMARY 23

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	262	DNSVDVYAFGILFWYICSGSVKL	284	PRIMARY	23

RH mapping information	Description

Chromosome No.

: 1

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: GGTTGTTAATCCCACTCTGAC
Primer_r	: GCTTGCTTTGGAGAGATGATG
PCR product length	: 99 bp
PCR conditions	: 95 °C15 sec62 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	4394 bp
Genome contig ID	gi89161185r_203279136
PolyA signal sequence (None)	+--------+--------+----*----+---- ACTCCAGCCTGGGCAGCAGAGCAAGACTCCATCTC
Flanking genome sequence (99780 - 99731)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAAGAAAAAGAAAAAGAAGGTTAATCCTTCAGTTATGGA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	1	r	203378916	203397914	8	99.1	Perfect prediction

Gene/Protein Characteristic Table for KIAA0472

Features of the cloned DNA sequence

Features of the protein sequence

RH mapping information