HUGE |
Gene/Protein Characteristic Table for KIAA0711 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK05564 |
---|---|
Accession No. : | AB018254 |
Description : | Kelch repeat and BTB domain-containing protein 11. |
HUGO Gene Name : | kelch repeat and BTB (POZ) domain containing 11 (KBTBD11) |
Clone Name : | hg00358 [Vector Info] |
Source : | Human adult brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 6706 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 3871 bp Genome contig ID gi51511724f_1809451 PolyA signal sequence
(AATAAA,-26) +----*----+----*----+----*----+----
CCGAGATGAAATAAATCACGCAGAAAGTGCCAGTCFlanking genome sequence
(133060 - 133109) ----+----*----+----*----+----*----+----*----+----*
CTCCTGATGTGCCCCGAGTGCTTTTCTCTTTCTCCACAGCGAGCGTCAGA
Chr f/r start end exon identity class ContigView(URL based/DAS) 8 f 1909451 1942509 2 99.0 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 661 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
---|---|---|
RT-PCR-ELISA | Description |
---|
Experimental conditions
: TCCTCCAAAGCCTGTTCAAGC | |
: GAACTGACAAACATACGAGGC | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 8 |
: GeneBridge 4 | |
: TCCTCCAAAGCCTGTTCAAGC | |
: GAACTGACAAACATACGAGGC | |
: 185 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |