HUGE

Gene/Protein Characteristic Table for KIAA1340

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK05757
Accession No. :	AB037761
Description :	Kelch domain-containing protein 5.
HUGO Gene Name :	kelch domain containing 5 (KLHDC5)
Clone Name :	fj00164 [Vector Info]
Source :	Human fetal brain

Features of the cloned DNA sequence	Description

Length: 3876 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 2550 bp

Genome contig ID gi89161190f_27724723
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
CTCCAGCCTGGGCGACAGTGCAAGACTCTGTCTTC
Flanking genome sequence None

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 12 f 27824723 27854900 4 99.1 Terminal No-hit

Features of the protein sequence	Description

Length: 441 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
AAH28742	1.7e-194	100.0	KLHDC5 protein ...	Homo sapiens
Q9P2K6	1.8e-194	100.0	Kelch domain-co...	Homo sapiens
XP_001916434	2.3e-190	97.7	kelch domain co...	Equus caballus
XP_001249627	2.8e-185	95.2	similar to kelc...	Bos taurus
EAW96570	1.1e-179	100.0	kelch domain co...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB018254	1.1e-20	29.6	KIAA0711
AB037775	1.3e-17	25.0	KIAA1354
AB037730	2e-17	25.4	KIAA1309
AB037805	8.9e-15	25.7	KIAA1384
AB067508	1.5e-10	24.3	KIAA1921

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR011705 66 105 PF07707 BTB/Kelch-associated

IPR006652 178 224 PF01344 Kelch repeat type 1

IPR006652 226 267 PF01344 Kelch repeat type 1

IPR006652 269 308 PF01344 Kelch repeat type 1

IPR006652 316 371 PF01344 Kelch repeat type 1

HMMSmart IPR006652 190 237 SM00612 Kelch repeat type 1

IPR006652 238 280 SM00612 Kelch repeat type 1

IPR006652 281 327 SM00612 Kelch repeat type 1

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR011705	66	105	PF07707	BTB/Kelch-associated
IPR006652	178	224	PF01344	Kelch repeat type 1
IPR006652	226	267	PF01344	Kelch repeat type 1
IPR006652	269	308	PF01344	Kelch repeat type 1
IPR006652	316	371	PF01344	Kelch repeat type 1
HMMSmart	IPR006652	190	237	SM00612	Kelch repeat type 1
IPR006652	238	280	SM00612	Kelch repeat type 1
IPR006652	281	327	SM00612	Kelch repeat type 1

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: AAAGGTGGAATGTGCAATAGG

Primer_r
: CTTCAATGTAATACTGGCACC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 12

Experimental conditions

Panel name	: unigene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	2550 bp
Genome contig ID	gi89161190f_27724723
PolyA signal sequence (None)	+--------+--------+----*----+---- CTCCAGCCTGGGCGACAGTGCAAGACTCTGTCTTC
Flanking genome sequence	None

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	12	f	27824723	27854900	4	99.1	Terminal No-hit

Primer_f	: AAAGGTGGAATGTGCAATAGG
Primer_r	: CTTCAATGTAATACTGGCACC
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1340

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information