HUGE |
Gene/Protein Characteristic Table for KIAA0715 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Mapping | |
Product ID : | ORK01674 |
---|---|
Accession No. : | AB018258 |
Description : | Probable phospholipid-transporting ATPase VB. |
HUGO Gene Name : | ATPase, class V, type 10B (ATP10B) |
Clone Name : | pf08610 [Vector Info] |
Flexi ORF Clone : | pF1KA0715
![]() |
Source : | Human brain (hippocampus) |
Note : | We replaced hj02886, former representative clones for KIAA0715 with pf08610. (1999/6/16) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 7380 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 2320 bp Genome contig ID gi51511721r_159822718 PolyA signal sequence
(AATAAA,-19) +----*----+----*----+----*----+----
GTCATCCTTTATTAAAAATAAACATGGTTTTCCATFlanking genome sequence
(100000 - 99951) ----+----*----+----*----+----*----+----*----+----*
AGTTGCCTGCCAACCTAAGTTCACATTATTCTTCTTTTATATCATTATCA
Chr f/r start end exon identity class ContigView(URL based/DAS) 5 r 159922718 160211624 26 99.9 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 1498 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
RH mapping information |
Description | |
---|---|---|
: 5 |
: GeneBridge 4 | |
: AGAACCTCCTCAGCAAAGATG | |
: ATGGCAGAGGCAGTGAAACAG | |
: 156 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |