| HUGE |
Gene/Protein Characteristic Table for KIAA1021 |
|
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
| Features : DNA sequence | Protein sequence | Expression | Mapping | |
| Product ID : | ORK04210 |
|---|---|
| Accession No. : | AB028944 |
| Description : | Probable phospholipid-transporting ATPase IH. |
| HUGO Gene Name : | ATPase, class VI, type 11A (ATP11A) |
| Clone Name : | af10412 [Vector Info] |
| Source : | Human brain (amygdala) |
| Note : | We replaced fg00592, former representative clones for KIAA1021 with af10412. (2005/08/06) |
Features of the cloned DNA sequence |
Description | |
|---|---|---|
Length: 7611 bp
|
| cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | YES |
Length of 3'UTR 4301 bp Genome contig ID gi51511729f_112387506 PolyA signal sequence
(None) +----*----+----*----+----*----+----
GCCAGCCTTCCGCCACGAGCCAGCTGGGAAGGGCCFlanking genome sequence
(200916 - 200965) ----+----*----+----*----+----*----+----*----+----*
GCGGCCGCCTAAAGCCCCAGTCAACCCAGCCTGTGTCTGAGCAGACAGGG
Chr f/r start end exon identity class ContigView(URL based/DAS) 13 f 112487506 112588420 29 99.4 Perfect prediction
Features of the protein sequence |
Description | |
|---|---|---|
Length: 1102 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
|---|---|---|
| RT-PCR-ELISA | Description |
|---|

Experimental conditions
| : GCATTGGACACACACTACTGG | |
| : AACACGTAGTACATCCTCTGG | |
| : 95 °C |
RH mapping information |
Description | |
|---|---|---|
| : 13 |
| : UniGene | |
| : - | |
| : - | |
| : - | |
| : - |
|
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage
| |