HUGE |
Gene/Protein Characteristic Table for KIAA0956 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK04211 |
---|---|
Accession No. : | AB023173 |
Description : | Probable phospholipid-transporting ATPase IF. |
HUGO Gene Name : | ATPase, class VI, type 11B (ATP11B) |
Clone Name : | hj05590 [Vector Info] |
Source : | Human adult brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 5542 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 3521 bp Genome contig ID gi89161205f_183966820 PolyA signal sequence
(AATAAA,-19) +----*----+----*----+----*----+----
GAAGTTATATTTATCAAATAAAAACTTTCCTATATFlanking genome sequence
(155291 - 155340) ----+----*----+----*----+----*----+----*----+----*
AATTAAAAGTGTTCCTTTATTTAAGCATTTTAAGCCTGTCTCTGTTTATC
Chr f/r start end exon identity class ContigView(URL based/DAS) 3 f 184066820 184122109 17 99.3 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 672 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
---|---|---|
RT-PCR-ELISA | Description |
---|
Experimental conditions
: GAACTTATCTGATCGCTTGAG | |
: CACGAGATTTTTCAGAGTAGC | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 3 |
: UniGene | |
: - | |
: - | |
: - | |
: - |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |