HUGE |
Gene/Protein Characteristic Table for KIAA1939 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK04227 |
---|---|
Accession No. : | AB075819 |
Description : | Probable phospholipid-transporting ATPase IM. |
HUGO Gene Name : | ATPase, class I, type 8B, member 4 (ATP8B4) |
Clone Name : | ah01164 [Vector Info] |
Source : | Human brain (amygdala) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 5782 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | YES |
Length of 3'UTR 1954 bp Genome contig ID gi51511731r_47837728 PolyA signal sequence
(AGTAAA,-24) +----*----+----*----+----*----+----
TGAAAACTTTCAGTAAATGTTTTGGCACTATTGGTFlanking genome sequence
(100000 - 99951) ----+----*----+----*----+----*----+----*----+----*
ACTTGATGTTTTATCTCTTCTTTATGGGAAATTCATTGGGGAGATTTTTG
Chr f/r start end exon identity class ContigView(URL based/DAS) 15 r 47937728 48192805 29 99.5 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 1082 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
---|---|---|
RT-PCR-ELISA | Description |
---|
Experimental conditions
: GTGCAGATAGCCTTGGATACC | |
: AGAGAATTACAAGCCAGATGC | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 15 |
: genbank | |
: - | |
: - | |
: - | |
: - |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |