| HUGE |
Gene/Protein Characteristic Table for KIAA1487 |
|
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
| Features : DNA sequence | Protein sequence | Expression | Mapping | |
| Product ID : | ORK04209 |
|---|---|
| Accession No. : | AB040920 |
| Description : | Probable phospholipid-transporting ATPase VD. |
| HUGO Gene Name : | ATPase, class V, type 10D (ATP10D) |
| Clone Name : | fj07249 [Vector Info] |
| Source : | Human fetal brain |
Features of the cloned DNA sequence |
Description | |
|---|---|---|
Length: 3992 bp
|
| cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 2037 bp Genome contig ID gi89161207f_47154940 PolyA signal sequence
(AATATA,-17) +----*----+----*----+----*----+----
CTTTGCTACAAAAATATTAATATATTTCATTACTGFlanking genome sequence
(135254 - 135303) ----+----*----+----*----+----*----+----*----+----*
AATGCTAAACTGTATTTCTTTTTAAAATTTGGAAAATTTTTAATTCTGAA
Chr f/r start end exon identity class ContigView(URL based/DAS) 4 f 47254940 47290192 12 99.4 Perfect prediction
Features of the protein sequence |
Description | |
|---|---|---|
Length: 650 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
|---|---|---|
| RT-PCR-ELISA | Description |
|---|

Experimental conditions
| : CATGTATGCTGGCTTTAGTTG | |
| : GAGCATGGAGATTCAGGAAGG | |
| : 95 °C |
RH mapping information |
Description | |
|---|---|---|
| : 4 |
| : unigene | |
| : - | |
| : - | |
| : - | |
| : - |
|
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage
| |