HUGE

Gene/Protein Characteristic Table for KIAA0787

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK04429
Accession No. :	AB018330
Description :	Calcium/calmodulin-dependent protein kinase kinase 2.
HUGO Gene Name :	calcium/calmodulin-dependent protein kinase kinase 2, beta (CAMKK2)
Clone Name :	hk05521s1 [Vector Info]
Source :	Human adult brain
Note :	We replaced hk05521, former representative clones for KIAA0787 with hk05521s1. (2002/5/10)

Features of the cloned DNA sequence	Description

Length: 4450 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 2774 bp

Genome contig ID gi89161190r_120059880
PolyA signal sequence
(AATAAA,-25)
+----*----+----*----+----*----+----
GTACAGTTGAAATAAACAGACAGCAAAATGGTGCC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAGCCTGGGCCTCTTGGGGAGGTTTGTATTGGTGATTGTTTATTTAGGCC

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 12 r 120159880 120196717 16 99.2 Perfect prediction

Features of the protein sequence	Description

Length: 557 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
EAW98247	0	99.6	calcium/calmodu...	Homo sapiens
XP_001093677	1.2e-216	98.6	similar to calc...	Macaca mulatta
Q96RR4	1.1e-210	98.9	Calcium/calmodu...	Homo sapiens
EAW98254	1.7e-210	98.7	calcium/calmodu...	Homo sapiens
AAK91829	1.7e-210	98.7	Ca2+/calmodulin...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
D43636	5.9e-20	32.5	KIAA0096
AB018324	6e-20	30.8	KIAA0781
AB058763	3.5e-19	31.0	KIAA1860
AB058714	1.1e-18	34.2	KIAA1811
AB023185	1.2e-18	31.8	KIAA0968

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

BlastProDom IPR000719 166 446 PD000001 Protein kinase

HMMPfam IPR000719 166 447 PF00069 Protein kinase

HMMSmart IPR001245 166 441 SM00219 Tyrosine protein kinase

IPR002290 166 447 SM00220 Serine/threonine protein kinase

ProfileScan IPR000719 166 447 PS50011 Protein kinase

ScanRegExp IPR000719 172 195 PS00107 Protein kinase

IPR008271 309 321 PS00108 Serine/threonine protein kinase

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR000719	166	446	PD000001	Protein kinase
HMMPfam	IPR000719	166	447	PF00069	Protein kinase
HMMSmart	IPR001245	166	441	SM00219	Tyrosine protein kinase
IPR002290	166	447	SM00220	Serine/threonine protein kinase
ProfileScan	IPR000719	166	447	PS50011	Protein kinase
ScanRegExp	IPR000719	172	195	PS00107	Protein kinase
IPR008271	309	321	PS00108	Serine/threonine protein kinase

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: AGAACCATGACCTCCACTTGC

Primer_r
: AAACAGAAGCATCGGGCATTG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 12

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: AGAACCATGACCTCCACTTGC
Primer_r	: AAACAGAAGCATCGGGCATTG
PCR product length	: 141 bp
PCR conditions	: 95 °C15 sec64 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	2774 bp
Genome contig ID	gi89161190r_120059880
PolyA signal sequence (AATAAA,-25)	+--------+--------+----*----+---- GTACAGTTGAAATAAACAGACAGCAAAATGGTGCC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAGCCTGGGCCTCTTGGGGAGGTTTGTATTGGTGATTGTTTATTTAGGCC

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	12	r	120159880	120196717	16	99.2	Perfect prediction

Gene/Protein Characteristic Table for KIAA0787

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information