HUGE |
Gene/Protein Characteristic Table for KIAA0787 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK04429 |
---|---|
Accession No. : | AB018330 |
Description : | Calcium/calmodulin-dependent protein kinase kinase 2. |
HUGO Gene Name : | calcium/calmodulin-dependent protein kinase kinase 2, beta (CAMKK2) |
Clone Name : | hk05521s1 [Vector Info] |
Source : | Human adult brain |
Note : | We replaced hk05521, former representative clones for KIAA0787 with hk05521s1. (2002/5/10) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 4450 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 2774 bp Genome contig ID gi89161190r_120059880 PolyA signal sequence
(AATAAA,-25) +----*----+----*----+----*----+----
GTACAGTTGAAATAAACAGACAGCAAAATGGTGCCFlanking genome sequence
(100000 - 99951) ----+----*----+----*----+----*----+----*----+----*
AAGCCTGGGCCTCTTGGGGAGGTTTGTATTGGTGATTGTTTATTTAGGCC
Chr f/r start end exon identity class ContigView(URL based/DAS) 12 r 120159880 120196717 16 99.2 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 557 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
---|---|---|
RT-PCR-ELISA | Description |
---|
Experimental conditions
: AGAACCATGACCTCCACTTGC | |
: AAACAGAAGCATCGGGCATTG | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 12 |
: GeneBridge 4 | |
: AGAACCATGACCTCCACTTGC | |
: AAACAGAAGCATCGGGCATTG | |
: 141 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |