HUGE |
Gene/Protein Characteristic Table for KIAA0823 |
Link to :
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK01607 |
---|---|
Accession No. : | AB020630 |
Description : | Protein phosphatase 1 regulatory inhibitor subunit 16B. |
HUGO Gene Name : | protein phosphatase 1, regulatory (inhibitor) subunit 16B (PPP1R16B) |
Clone Name : | hh02763s1 [Vector Info] |
Flexi ORF Clone : | pF1KSDA0823
![]() |
Source : | Human adult brain |
Note : | We replaced hh02763, former representative clones for KIAA0823 with hh02763s1. (2002/5/10) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 6250 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 4357 bp Genome contig ID gi51511747f_36767762 PolyA signal sequence
(ATTAAA,-20) +----*----+----*----+----*----+----
TTTTTAATTAAAATTATTAAATTCCTTTTAATAACFlanking genome sequence
(217320 - 217369) ----+----*----+----*----+----*----+----*----+----*
ACCTGCTAGTGTGAGTGATTATTGCTGTGAGCTCACTTGAACAGTGCTGA
Chr f/r start end exon identity class ContigView(URL based/DAS) 20 f 36867762 36985080 11 99.2 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 578 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
---|---|---|
RT-PCR-ELISA | Description |
---|
Experimental conditions
: CTGAGGTAACTTCCACGTAGC | |
: AAGCAACTCCAGGGACATGTG | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 20 |
: UniGene | |
: - | |
: - | |
: - | |
: - |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |