HUGE

Gene/Protein Characteristic Table for KIAA1436

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK01630
Accession No. :	AB037857
Description :	Prostaglandin F2 receptor negative regulator precursor.
HUGO Gene Name :	prostaglandin F2 receptor negative regulator (PTGFRN)
Clone Name :	hh15451 [Vector Info]
Flexi ORF Clone :	pF1KSDA1436
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 6160 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 3383 bp

Genome contig ID gi89161185f_117154212
PolyA signal sequence
(ATTAAA,-19)
+----*----+----*----+----*----+----
ATTTGTTTTTTATTTCATTAAAGGAAGTTTAATTT
Flanking genome sequence
(180285 - 180334)
----+----*----+----*----+----*----+----*----+----*
AAATTGAAGTTGTGTGAGGAGCTTGATATTGGCCTCTGTCCTTTCATATC

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 1 f 117254212 117334495 9 99.9 Perfect prediction

Features of the protein sequence	Description

Length: 924 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_001103382	98.5	prostaglandin F...	Macaca mulatta
Q9P2B2	100.0	Prostaglandin F...	Homo sapiens
BAC11104	99.8	unnamed protein...	Homo sapiens
CAI26224	90.0	prostaglandin F...	Mus musculus
EDL07630	90.1	prostaglandin F...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB007935	1.8e-37	26.3	KIAA0466

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR013106 66 186 PF07686 Immunoglobulin V-set

IPR013151 207 294 PF00047 Immunoglobulin

IPR013106 321 421 PF07686 Immunoglobulin V-set

IPR013151 467 562 PF00047 Immunoglobulin

HMMSmart IPR003599 73 186 SM00409 Immunoglobulin subtype

IPR003596 83 166 SM00406 Immunoglobulin V-set

IPR003599 199 315 SM00409 Immunoglobulin subtype

IPR003599 329 435 SM00409 Immunoglobulin subtype

IPR003596 339 420 SM00406 Immunoglobulin V-set

IPR003599 459 577 SM00409 Immunoglobulin subtype

IPR003596 469 562 SM00406 Immunoglobulin V-set

IPR003599 601 721 SM00409 Immunoglobulin subtype

IPR003599 741 867 SM00409 Immunoglobulin subtype

ProfileScan IPR007110 53 174 PS50835 Immunoglobulin-like

IPR007110 194 313 PS50835 Immunoglobulin-like

IPR007110 321 439 PS50835 Immunoglobulin-like

IPR007110 451 581 PS50835 Immunoglobulin-like

IPR007110 733 858 PS50835 Immunoglobulin-like

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR013106	66	186	PF07686	Immunoglobulin V-set
IPR013151	207	294	PF00047	Immunoglobulin
IPR013106	321	421	PF07686	Immunoglobulin V-set
IPR013151	467	562	PF00047	Immunoglobulin
HMMSmart	IPR003599	73	186	SM00409	Immunoglobulin subtype
IPR003596	83	166	SM00406	Immunoglobulin V-set
IPR003599	199	315	SM00409	Immunoglobulin subtype
IPR003599	329	435	SM00409	Immunoglobulin subtype
IPR003596	339	420	SM00406	Immunoglobulin V-set
IPR003599	459	577	SM00409	Immunoglobulin subtype
IPR003596	469	562	SM00406	Immunoglobulin V-set
IPR003599	601	721	SM00409	Immunoglobulin subtype
IPR003599	741	867	SM00409	Immunoglobulin subtype
ProfileScan	IPR007110	53	174	PS50835	Immunoglobulin-like
IPR007110	194	313	PS50835	Immunoglobulin-like
IPR007110	321	439	PS50835	Immunoglobulin-like
IPR007110	451	581	PS50835	Immunoglobulin-like
IPR007110	733	858	PS50835	Immunoglobulin-like

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

SOSUI2 1 878 LLIGVGLSTVIGLLSCLIGYCSS 900 PRIMARY 23

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	878	LLIGVGLSTVIGLLSCLIGYCSS	900	PRIMARY	23

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: TCAGGATTTTATTGGCACAGG

Primer_r
: TCAATGCCTTAACAACTCCAG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 1

Experimental conditions

Panel name	: unigene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	3383 bp
Genome contig ID	gi89161185f_117154212
PolyA signal sequence (ATTAAA,-19)	+--------+--------+----*----+---- ATTTGTTTTTTATTTCATTAAAGGAAGTTTAATTT
Flanking genome sequence (180285 - 180334)	----+--------+--------+--------+--------+----* AAATTGAAGTTGTGTGAGGAGCTTGATATTGGCCTCTGTCCTTTCATATC

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	1	f	117254212	117334495	9	99.9	Perfect prediction

Primer_f	: TCAGGATTTTATTGGCACAGG
Primer_r	: TCAATGCCTTAACAACTCCAG
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1436

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information