HUGE

Gene/Protein Characteristic Table for KIAA1444

Link to : GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK06323
Accession No. :	AB040877
Description :	PDZ domain-containing protein 4.
HUGO Gene Name :	PDZ domain containing 4 (PDZD4)
Clone Name :	fg03469a [Vector Info]
Source :	Human fetal brain

Features of the cloned DNA sequence	Description

Length: 1248 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 0 bp

Genome contig ID gi89161218r_152622671
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
CCGGCCGGAGGCAGCACGCGGAGGAGCGCGGCCGC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
CGCAACCCCAAGACGGGGTTGACCCTGGAGCGTGTGGGCCCTGAAAGCAG

Features of the protein sequence	Description

Length: 416 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
EAW72798	9.2e-149	100.0	hCG2004980, iso...	Homo sapiens
AAI43460	9.2e-149	100.0	Unknown (protei...	Homo sapiens
EAW72791	9.4e-149	100.0	hCG2004980, iso...	Homo sapiens
EAW72802	9.6e-149	100.0	hCG2004980, iso...	Homo sapiens
Q76G19	1e-148	100.0	PDZ domain-cont...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB029018	4.2e-42	49.9	KIAA1095

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR001478 1 81 PF00595 PDZ/DHR/GLGF

HMMSmart IPR001478 9 84 SM00228 PDZ/DHR/GLGF

ProfileScan IPR001478 1 68 PS50106 PDZ/DHR/GLGF

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001478	1	81	PF00595	PDZ/DHR/GLGF
HMMSmart	IPR001478	9	84	SM00228	PDZ/DHR/GLGF
ProfileScan	IPR001478	1	68	PS50106	PDZ/DHR/GLGF

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: TGTATAAAAGCAGCCACCGGG

Primer_r
: ACCTCTCCGACATAAATGCCC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: X

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: TGTATAAAAGCAGCCACCGGG
Primer_r	: ACCTCTCCGACATAAATGCCC
PCR product length	: 91 bp
PCR conditions	: 95 °C15 sec64 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	0 bp
Genome contig ID	gi89161218r_152622671
PolyA signal sequence (None)	+--------+--------+----*----+---- CCGGCCGGAGGCAGCACGCGGAGGAGCGCGGCCGC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* CGCAACCCCAAGACGGGGTTGACCCTGGAGCGTGTGGGCCCTGAAAGCAG

Gene/Protein Characteristic Table for KIAA1444

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information