HUGE

Gene/Protein Characteristic Table for KIAA1497

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK05885
Accession No. :	AB040930
Description :	Leucine-rich repeat neuronal protein 1 precursor.
HUGO Gene Name :
Clone Name :	hg01608 [Vector Info]
Flexi ORF Clone :	pF1KA1497
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 6250 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 833 bp

Genome contig ID gi89161205f_3758125
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
AAATTAGTTTTGTTCTGATTTTTTAGAACACTTGC
Flanking genome sequence
(106188 - 106237)
----+----*----+----*----+----*----+----*----+----*
AATAATGTATCATTTATAGTTCTTGCTAGTTGCAGTGGTAATATTTTTCA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 3 f 3857911 3864311 2 99.0 Perfect prediction

Features of the protein sequence	Description

Length: 730 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q6UXK5	100.0	Leucine-rich re...	Homo sapiens
AAH34947	99.9	Leucine rich re...	Homo sapiens
BAF84406	99.9	unnamed protein...	Homo sapiens
XP_526119	99.7	leucine rich re...	Pan troglodytes
XP_001099632	99.0	leucine rich re...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB007865	1.9e-13	24.0	KIAA0405
AB007876	5.8e-12	29.1	KIAA0416
AB011537	8e-11	26.3	KIAA0813
AB014544	2.8e-10	26.9	KIAA0644
AB011538	2.1e-09	24.4	KIAA0814

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

FPrintScan IPR001611 111 124 PR00019 Leucine-rich repeat

IPR001611 180 193 PR00019 Leucine-rich repeat

HMMPfam IPR001611 110 132 PF00560 Leucine-rich repeat

IPR001611 134 156 PF00560 Leucine-rich repeat

IPR001611 158 180 PF00560 Leucine-rich repeat

IPR001611 230 252 PF00560 Leucine-rich repeat

IPR001611 254 276 PF00560 Leucine-rich repeat

IPR001611 278 300 PF00560 Leucine-rich repeat

IPR000483 410 437 PF01463 Cysteine-rich flanking region

IPR013098 438 530 PF07679 Immunoglobulin I-set

IPR003961 537 619 PF00041 Fibronectin

HMMSmart NULL 108 129 SM00365 NULL

IPR003591 108 131 SM00369 Leucine-rich repeat

IPR003591 132 155 SM00369 Leucine-rich repeat

IPR003591 156 179 SM00369 Leucine-rich repeat

NULL 156 182 SM00365 NULL

IPR003591 180 203 SM00369 Leucine-rich repeat

IPR003591 228 251 SM00369 Leucine-rich repeat

IPR003591 252 275 SM00369 Leucine-rich repeat

NULL 252 273 SM00365 NULL

NULL 276 297 SM00365 NULL

IPR003591 276 299 SM00369 Leucine-rich repeat

IPR003591 325 349 SM00369 Leucine-rich repeat

IPR003591 350 373 SM00369 Leucine-rich repeat

IPR000483 385 437 SM00082 Cysteine-rich flanking region

IPR003599 446 531 SM00409 Immunoglobulin subtype

IPR003598 452 520 SM00408 Immunoglobulin subtype 2

ProfileScan IPR007110 438 529 PS50835 Immunoglobulin-like

IPR003961 536 628 PS50853 Fibronectin

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR001611	111	124	PR00019	Leucine-rich repeat
IPR001611	180	193	PR00019	Leucine-rich repeat
HMMPfam	IPR001611	110	132	PF00560	Leucine-rich repeat
IPR001611	134	156	PF00560	Leucine-rich repeat
IPR001611	158	180	PF00560	Leucine-rich repeat
IPR001611	230	252	PF00560	Leucine-rich repeat
IPR001611	254	276	PF00560	Leucine-rich repeat
IPR001611	278	300	PF00560	Leucine-rich repeat
IPR000483	410	437	PF01463	Cysteine-rich flanking region
IPR013098	438	530	PF07679	Immunoglobulin I-set
IPR003961	537	619	PF00041	Fibronectin
HMMSmart	NULL	108	129	SM00365	NULL
IPR003591	108	131	SM00369	Leucine-rich repeat
IPR003591	132	155	SM00369	Leucine-rich repeat
IPR003591	156	179	SM00369	Leucine-rich repeat
NULL	156	182	SM00365	NULL
IPR003591	180	203	SM00369	Leucine-rich repeat
IPR003591	228	251	SM00369	Leucine-rich repeat
IPR003591	252	275	SM00369	Leucine-rich repeat
NULL	252	273	SM00365	NULL
NULL	276	297	SM00365	NULL
IPR003591	276	299	SM00369	Leucine-rich repeat
IPR003591	325	349	SM00369	Leucine-rich repeat
IPR003591	350	373	SM00369	Leucine-rich repeat
IPR000483	385	437	SM00082	Cysteine-rich flanking region
IPR003599	446	531	SM00409	Immunoglobulin subtype
IPR003598	452	520	SM00408	Immunoglobulin subtype 2
ProfileScan	IPR007110	438	529	PS50835	Immunoglobulin-like
IPR003961	536	628	PS50853	Fibronectin

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

SOSUI2 1 16 ARMSFVIAACQLVLGLLMTSLTE 38 SECONDARY 23

2 644 TALAAVMGSMFAVISLASIAVYF 666 PRIMARY 23

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	16	ARMSFVIAACQLVLGLLMTSLTE	38	SECONDARY	23
2	644	TALAAVMGSMFAVISLASIAVYF	666	PRIMARY	23

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: TGCAGCCTTCCACAGATTATG

Primer_r
: AAAGTACACAGCAATGGACGC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 3

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: ACATACGGTTTTGAAGCAGCC
Primer_r	: CATTCAACGAGGTAACAAGTC
PCR product length	: 99 bp
PCR conditions	: 95 °C15 sec62 °C60 sec35 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	833 bp
Genome contig ID	gi89161205f_3758125
PolyA signal sequence (None)	+--------+--------+----*----+---- AAATTAGTTTTGTTCTGATTTTTTAGAACACTTGC
Flanking genome sequence (106188 - 106237)	----+--------+--------+--------+--------+----* AATAATGTATCATTTATAGTTCTTGCTAGTTGCAGTGGTAATATTTTTCA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	3	f	3857911	3864311	2	99.0	Perfect prediction

Primer_f	: TGCAGCCTTCCACAGATTATG
Primer_r	: AAAGTACACAGCAATGGACGC
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1497

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information