Gene/Protein Characteristic Table for KIAA0178
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK01055
Accession No D80000
Description structural maintenance of chromosomes 1A, transcript variant 1
Clone name ha02501s1
Vector information
The cDNA fragment was originally inserted at the EcoRV-NotI ...
cDNA sequence DNA sequence (5825 bp)
Predicted protein sequence (1233 aa)
Flexi ORF Clone FXC01055
Source Myeloblast cell line (KG-1)
Rouge ID mKIAA0178 by Kazusa Mouse cDNA Project
Note We replaced ha02501, former representative clones for KIAA0178 with ha02501s1. (2002/5/10)
Features of the cloned cDNA sequence
Description

Length: 5825 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq Warning No warning
Integrity of 3' end
Length of 3'UTR 2123 bp
Genome contig ID gi89161218r_53321626
PolyA signal sequence
(ATTAAA,-24)
+----*----+----*----+----*----+----
TTCTAATACATATTAAAAGACATAACTATCAAAAC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAAATAAATTTGTCTGTTTTCAACCAAAGAAGTCACGTACCACTGGTGGT
Features of the protein sequence
Description

Length: 1233 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
XP_538049 0 99.9 similar to Stru...
Canis lupus fam...
AAB34405 0 99.8 mitosis-specifi...
Homo sapiens
O97593 0 99.8 Structural main...
Bos taurus
CAM23830 0 99.8 structural main...
Mus musculus
EDL86308 0 99.8 structural main...
Rattus norvegicus
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
Entry Exp ID% HUGE_ID
AB111886 2.8e-05 21.4 KIAA2034
AB020673 7.4e-05 22.6 KIAA0866
AB040945 0.00011 22.1 KIAA1512
AB014519 0.00026 23.2 KIAA0619
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
BlastProDom IPR003439 1128 1163 PD000006 ABC transporter related
HMMPfam IPR003395 3 1212 PF02463 SMC protein
IPR010935 511 629 PF06470 SMCs flexible hinge
ScanRegExp IPR003439 1128 1142 PS00211 ABC transporter related
Expression profile
Description

Northern blot
Experimental conditions
Primer_f
Primer_r
PCR conditions test

RH mapping information
Description

Chromosome No. X
Experimental conditions
Panel name Genebridge 4
Primer_f AATACTACACAGGAGCATCAC
Primer_r AGACCTCAGATCAACCTCAAG
PCR product length 184 bp
PCR conditions 95 °C15 sec66 °C60 sec30 cycles
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp