Order Kazusa clone(s) from :
Japan
||
Other countries |
Product ID | ORK01055 |
---|---|
Accession No | D80000 |
Description | structural maintenance of chromosomes 1A, transcript variant 1 |
Clone name | ha02501s1 |
Vector information | |
cDNA sequence | DNA sequence (5825 bp) Predicted protein sequence (1233 aa) |
HaloTag ORF Clone |
FHC01055
|
Flexi ORF Clone | FXC01055 |
Source | Myeloblast cell line (KG-1) |
Rouge ID |
mKIAA0178
by Kazusa Mouse cDNA Project
|
Note | We replaced ha02501, former representative clones for KIAA0178 with ha02501s1. (2002/5/10) |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 2123 bp |
---|---|
Genome contig ID | gi89161218r_53321626 |
PolyA signal sequence (ATTAAA,-24) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.Result of homology search against HUGE database (FASTA output, Multiple alignment)
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Panel name | Genebridge 4 |
---|---|
Primer_f | AATACTACACAGGAGCATCAC |
Primer_r | AGACCTCAGATCAACCTCAAG |
PCR product length | 184 bp |
PCR conditions | 95 °C15 sec66 °C60 sec30 cycles |