KIAA0850

Product ID	ORK00137
Accession No	AB020657
Description	influenza virus NS1A binding protein
Clone name	hk05995
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (3682 bp) Predicted protein sequence (644 aa)
HaloTag ORF Clone	FHC00137
Flexi ORF Clone	FXC00137
Source	Human adult brain
Rouge ID	mKIAA0850 by Kazusa Mouse cDNA Project

Length: 3682 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	1123 bp
Genome contig ID	gi89161185r_183432667
PolyA signal sequence (ATTAAA,-19)	+--------+--------+----*----+---- CTGCTGATTTAAACACATTAAAGGTACTTTGCAGG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAATCCTTGCACCATGGGATTAATATCCAATTGCTGCTTGTACACTCATT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	1	r	183532667	183553091	15	100.0	Perfect prediction

Length: 644 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q9Y6Y0	100.0	Influenza virus...	Homo sapiens
ABE03889	99.8	aryl hydrocarbo...	Homo sapiens
AAH67739	99.8	IVNS1ABP protei...	Homo sapiens
XP_001113590	99.5	similar to infl...	Macaca mulatta
XP_514060	99.4	influenza virus...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB032955	1.5e-32	29.3	KIAA1129
D50922	1.7e-29	29.4	KIAA0132
AB037799	3.8e-28	26.0	KIAA1378
AB018338	6e-25	27.4	KIAA0795
AB051474	1.5e-21	29.0	KIAA1687

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR006651	560	573	PR00501	Kelch
	IPR006651	577	591	PR00501	Kelch
	IPR006651	592	604	PR00501	Kelch
HMMPfam	IPR013069	24	131	PF00651	BTB/POZ
	IPR011705	136	235	PF07707	BTB/Kelch-associated
	IPR006652	359	404	PF01344	Kelch repeat type 1
	IPR006652	406	452	PF01344	Kelch repeat type 1
	IPR006652	454	501	PF01344	Kelch repeat type 1
	IPR006652	503	548	PF01344	Kelch repeat type 1
	IPR006652	550	595	PF01344	Kelch repeat type 1
	IPR006652	597	637	PF01344	Kelch repeat type 1
HMMSmart	IPR000210	34	131	SM00225	BTB/POZ-like
	IPR006652	371	417	SM00612	Kelch repeat type 1
	IPR006652	418	465	SM00612	Kelch repeat type 1
	IPR006652	466	514	SM00612	Kelch repeat type 1
	IPR006652	515	561	SM00612	Kelch repeat type 1
	IPR006652	562	608	SM00612	Kelch repeat type 1
	IPR006652	609	643	SM00612	Kelch repeat type 1
ProfileScan	IPR000210	34	101	PS50097	BTB/POZ-like

Primer_f	AACAGTCCTAAATAGCAGCCC
Primer_r	CCATAAGTTAGGTGTGTAGCA
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	AACAGTCCTAAATAGCAGCCC
Primer_r	CCATAAGTTAGGTGTGTAGCA
PCR product length	174 bp
PCR conditions	95 °C15 sec62 °C60 sec30 cycles