KIAA1163

Product ID	ORK04094
Accession No	AB032989
Description	adhesion molecule with Ig-like domain 1
Clone name	hj05329
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4568 bp) Predicted protein sequence (437 aa)
Source	Human adult brain
Rouge ID	mKIAA1163 by Kazusa Mouse cDNA Project

Length: 4568 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	3252 bp
Genome contig ID	gi89161185r_109748324
PolyA signal sequence (ATTAAA,-30)	+--------+--------+----*----+---- TGATCATTAAACCTGGCTTGAGTCTCTGTTCTGGC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ACAATCTGACTGGTTTATTTTTTCAGCCTGTGGGTGGGGTTCACTGTACC

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	1	r	109848324	109852891	1	99.0	Perfect prediction

Length: 437 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q86WK6	4.9e-180	100.0	Amphoterin-indu...	Homo sapiens
AAH40879	1.2e-179	99.8	Adhesion molecu...	Homo sapiens
XP_547241	1.9e-173	96.3	similar to Amph...	Canis lupus fam...
AAI51606	4.6e-173	95.9	AMIGO1 protein ...	Bos taurus
XP_001494891	1.4e-171	95.4	similar to LOC5...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB058754	4e-23	37.3	KIAA1851
D86983	2.5e-12	28.2	KIAA0230
AB020725	1.5e-07	31.4	KIAA0918
AB058757	2.5e-07	26.2	KIAA1854
AB020655	3.3e-07	29.6	KIAA0848

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR001611	56	69	PR00019	Leucine-rich repeat
FPrintScan	IPR001611	128	141	PR00019	Leucine-rich repeat
HMMPfam	IPR001611	31	53	PF00560	Leucine-rich repeat
	IPR001611	55	77	PF00560	Leucine-rich repeat
	IPR001611	103	121	PF00560	Leucine-rich repeat
	IPR001611	130	152	PF00560	Leucine-rich repeat
	IPR013151	227	287	PF00047	Immunoglobulin
HMMSmart	IPR003591	29	52	SM00369	Leucine-rich repeat
	IPR003591	53	76	SM00369	Leucine-rich repeat
	IPR003591	77	100	SM00369	Leucine-rich repeat
	IPR003591	101	124	SM00369	Leucine-rich repeat
	IPR003591	128	151	SM00369	Leucine-rich repeat
	IPR000483	165	215	SM00082	Cysteine-rich flanking region
	IPR003599	219	303	SM00409	Immunoglobulin subtype
ProfileScan	IPR007110	227	297	PS50835	Immunoglobulin-like

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	316	TAYTTLVGCILSVVLVLIYLYLT	338	PRIMARY	23

Primer_f	TGAGTTTGAGACACCTGGTAG
Primer_r	TTCTAGTGCGCTTACATATGC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	unigene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-