KIAA1851

Product ID	ORK00287
Accession No	AB058754
Description	adhesion molecule with Ig-like domain 3
Clone name	hg04492
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (6077 bp) Predicted protein sequence (523 aa)
HaloTag ORF Clone	FHC00287
Flexi ORF Clone	FXC00287
Source	Human adult brain
Rouge ID	mKIAA1851 by Kazusa Mouse cDNA Project

Length: 6077 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	Warning

Integrity of 3' end

Length of 3'UTR	1107 bp
Genome contig ID	gi89161205r_49629281
PolyA signal sequence (AATAAA,-28)	+--------+--------+----*----+---- AGAGTTTAATAAAGGTAGCACATGCTTATTGCTAG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AGCCTTTGCAGACAATGGCGGTCCTCCGTGTGTTCAGCTCTCCTGGCGGC

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	3	r	49729281	49736353	10	99.1	Perfect prediction

Length: 523 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q86WK7	0	100.0	Amphoterin-indu...	Homo sapiens
AAI01366	0	99.8	Adhesion molecu...	Homo sapiens
XP_001107400	2.4e-212	96.4	similar to amph...	Macaca mulatta
XP_850642	1.5e-182	82.5	similar to GDP-...	Canis lupus fam...
Q80ZD5	5e-170	78.7	Amphoterin-indu...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB032989	5.4e-25	37.3	KIAA1163
AB011538	7.4e-14	29.0	KIAA0814
AB011537	1.9e-12	31.9	KIAA0813
AB007876	8.4e-10	33.0	KIAA0416
D86983	1.4e-09	27.1	KIAA0230

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR001611	130	143	PR00019	Leucine-rich repeat
FPrintScan	IPR001611	201	214	PR00019	Leucine-rich repeat
HMMPfam	IPR000372	52	79	PF01462	Leucine-rich repeat
	IPR001611	105	127	PF00560	Leucine-rich repeat
	IPR001611	129	151	PF00560	Leucine-rich repeat
	IPR001611	153	175	PF00560	Leucine-rich repeat
	IPR001611	177	199	PF00560	Leucine-rich repeat
	IPR001611	203	225	PF00560	Leucine-rich repeat
HMMSmart	IPR003591	78	102	SM00369	Leucine-rich repeat
	IPR003591	103	126	SM00369	Leucine-rich repeat
	IPR003591	128	150	SM00369	Leucine-rich repeat
	IPR003591	151	174	SM00369	Leucine-rich repeat
	IPR003591	175	195	SM00369	Leucine-rich repeat
	IPR003591	202	225	SM00369	Leucine-rich repeat
	IPR003599	304	391	SM00409	Immunoglobulin subtype
	IPR003598	310	378	SM00408	Immunoglobulin subtype 2
ProfileScan	IPR007110	296	389	PS50835	Immunoglobulin-like

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	10	CSVLSLVVAAMTWLVLLGTLLCM	32	PRIMARY	23
SOSUI2	2	403	GFTTLLGCAVGLVLVLLYLFAPP	425	PRIMARY	23

Primer_f	GCTTCACAACTTCACGCAGAG
Primer_r	GATCCCCTTCACTGTGTCTTG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	unigene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-