Gene/Protein Characteristic Table for FLJ00014
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK06761
Accession No AK024425
Clone name as00014
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (4469 bp)
Predicted protein sequence (725 aa)
Source Human spleen
Features of the cloned cDNA sequence
Description

Length: 4469 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq Warning No warning
Features of the protein sequence
Description

Length: 725 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAB15715 0 100.0 FLJ00014 protei...
Homo sapiens
Q9NS98 0 100.0 Semaphorin-3G; ...
Homo sapiens
XP_001172139 0 99.7 semaphorin sem2...
Pan troglodytes
XP_516513 0 99.7 semaphorin sem2...
Pan troglodytes
XP_224613 0 87.5 similar to sema...
Rattus norvegicus
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against other entries from Kazusa human cDNA project (FASTA output, Multiple alignment)
Entry Exp ID% HUGE_ID
AB002329 2.6e-131 51.3 KIAA0331
AB051526 1.4e-46 33.6 KIAA1739
AB051532 3.1e-42 35.0 KIAA1745
AB046839 9.3e-42 33.5 KIAA1619
AB040912 2.4e-27 34.7 KIAA1479
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR001627 1 446 PF01403 Semaphorin/CD100 antigen
IPR002165 464 517 PF01437 Plexin
IPR007110 539 600 PF00047 Immunoglobulin-like
HMMSmart IPR003659 464 517 SM00423 Plexin/semaphorin/integrin
ProfileScan IPR007110 512 599 PS50835 Immunoglobulin-like
Expression profile
Description

RT-PCR-ELISA
Experimental conditions
Primer_f TGTAAGTCCCGCTGATTCTCG
Primer_r TTCCAGCCAGTTTTGTGTGTC
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles
Order Kazusa clone(s) from : Japan || Other countries
Back to the NEDO Protein Database homepage
Send a message to office AT kazusa.or.jp