|
Order Kazusa clone(s) from : |
| Product ID | ORK06761 |
|---|---|
| Accession No | AK024425 |
| Clone name | as00014 |
| Vector information | |
| cDNA sequence | DNA sequence (4469 bp) Predicted protein sequence (725 aa) |
| Source | Human spleen |
Length: 4469 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).
| N-terminal truncation | Coding interruption | |
|---|---|---|
| cloned DNA seq | Warning | No warning |
Length: 725 aa
Result of homology search against nr database
(FASTA output,
Multiple alignment)![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against other entries from Kazusa human cDNA project
(FASTA output,
Multiple alignment)![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)
Result of InterProScan
| Search method | interpro_ID | From | To | Entry | Definition |
|---|---|---|---|---|---|
| HMMPfam | IPR001627 | 1 | 446 | PF01403 | Semaphorin/CD100 antigen |
| IPR002165 | 464 | 517 | PF01437 | Plexin | |
| IPR007110 | 539 | 600 | PF00047 | Immunoglobulin-like | |
| HMMSmart | IPR003659 | 464 | 517 | SM00423 | Plexin/semaphorin/integrin |
| ProfileScan | IPR007110 | 512 | 599 | PS50835 | Immunoglobulin-like |
RT-PCR-ELISA
|
Experimental conditions| Primer_f | TGTAAGTCCCGCTGATTCTCG |
|---|---|
| Primer_r | TTCCAGCCAGTTTTGTGTGTC |
| PCR conditions | 95 °C 30 sec 55 °C 30 sec 72 °C 60 sec 30 cycles![]() |