|
Order Kazusa clone(s) from : |
| Product ID | ORK07494 |
|---|---|
| Accession No | AB075828 |
| Description | ZFP82 zinc finger protein |
| Clone name | fh24556 |
| Vector information | |
| cDNA sequence | DNA sequence (5718 bp) Predicted protein sequence (487 aa) |
| Source | Human fetal brain |
| Rouge ID |
mKIAA1948
by Kazusa Mouse cDNA Project
|
Length: 5718 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).
| N-terminal truncation | Coding interruption | |
|---|---|---|
| cloned DNA seq | No warning | No warning |
Integrity of 3' end
| Length of 3'UTR | 2391 bp |
|---|---|
| Genome contig ID | gi42406306r_41473233 |
| PolyA signal sequence (AATACA,-10) |
+----*----+----*----+----*----+---- |
| Flanking genome sequence (99859 - 99810) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
| Chr | f/r | start | end | exon | identity | class | |
|---|---|---|---|---|---|---|---|
|
| 19 | r | 41573092 | 41578809 | 1 | 99.0 | Perfect prediction |
Length: 487 aa
Result of homology search against nr database
(FASTA output,
Multiple alignment)![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database
(FASTA output,
Multiple alignment)![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)
Result of InterProScan
| Search method | interpro_ID | From | To | Entry | Definition |
|---|---|---|---|---|---|
| BlastProDom | IPR007087 | 125 | 148 | PD000003 | Zinc finger |
| IPR007087 | 153 | 176 | PD000003 | Zinc finger | |
| IPR007087 | 181 | 203 | PD000003 | Zinc finger | |
| IPR007087 | 209 | 232 | PD000003 | Zinc finger | |
| IPR007087 | 237 | 257 | PD000003 | Zinc finger | |
| IPR007087 | 265 | 288 | PD000003 | Zinc finger | |
| IPR007087 | 293 | 316 | PD000003 | Zinc finger | |
| IPR007087 | 321 | 344 | PD000003 | Zinc finger | |
| IPR007087 | 349 | 371 | PD000003 | Zinc finger | |
| IPR007087 | 377 | 399 | PD000003 | Zinc finger | |
| IPR007087 | 405 | 428 | PD000003 | Zinc finger | |
| IPR007087 | 433 | 456 | PD000003 | Zinc finger | |
| IPR007087 | 461 | 483 | PD000003 | Zinc finger | |
| HMMPfam | IPR007087 | 125 | 147 | PF00096 | Zinc finger |
| IPR007087 | 153 | 175 | PF00096 | Zinc finger | |
| IPR007087 | 181 | 203 | PF00096 | Zinc finger | |
| IPR007087 | 209 | 231 | PF00096 | Zinc finger | |
| IPR007087 | 237 | 259 | PF00096 | Zinc finger | |
| IPR007087 | 293 | 315 | PF00096 | Zinc finger | |
| IPR007087 | 321 | 343 | PF00096 | Zinc finger | |
| IPR007087 | 349 | 371 | PF00096 | Zinc finger | |
| IPR007087 | 377 | 399 | PF00096 | Zinc finger | |
| IPR007087 | 405 | 427 | PF00096 | Zinc finger | |
| IPR007087 | 433 | 455 | PF00096 | Zinc finger | |
| IPR007087 | 461 | 483 | PF00096 | Zinc finger | |
| HMMSmart | IPR015880 | 125 | 147 | SM00355 | Zinc finger |
| IPR015880 | 153 | 175 | SM00355 | Zinc finger | |
| IPR015880 | 181 | 203 | SM00355 | Zinc finger | |
| IPR015880 | 209 | 231 | SM00355 | Zinc finger | |
| IPR015880 | 237 | 257 | SM00355 | Zinc finger | |
| IPR015880 | 265 | 287 | SM00355 | Zinc finger | |
| IPR015880 | 293 | 315 | SM00355 | Zinc finger | |
| IPR015880 | 321 | 343 | SM00355 | Zinc finger | |
| IPR015880 | 349 | 371 | SM00355 | Zinc finger | |
| IPR015880 | 377 | 399 | SM00355 | Zinc finger | |
| IPR015880 | 405 | 427 | SM00355 | Zinc finger | |
| IPR015880 | 433 | 455 | SM00355 | Zinc finger | |
| IPR015880 | 461 | 483 | SM00355 | Zinc finger | |
| ProfileScan | IPR007087 | 125 | 152 | PS50157 | Zinc finger |
| IPR007087 | 153 | 180 | PS50157 | Zinc finger | |
| IPR007087 | 181 | 208 | PS50157 | Zinc finger | |
| IPR007087 | 209 | 236 | PS50157 | Zinc finger | |
| IPR007087 | 237 | 264 | PS50157 | Zinc finger | |
| IPR007087 | 265 | 292 | PS50157 | Zinc finger | |
| IPR007087 | 293 | 320 | PS50157 | Zinc finger | |
| IPR007087 | 321 | 348 | PS50157 | Zinc finger | |
| IPR007087 | 349 | 376 | PS50157 | Zinc finger | |
| IPR007087 | 377 | 404 | PS50157 | Zinc finger | |
| IPR007087 | 405 | 432 | PS50157 | Zinc finger | |
| IPR007087 | 433 | 460 | PS50157 | Zinc finger | |
| IPR007087 | 461 | 487 | PS50157 | Zinc finger | |
| ScanRegExp | IPR007087 | 127 | 147 | PS00028 | Zinc finger |
| IPR007087 | 155 | 175 | PS00028 | Zinc finger | |
| IPR007087 | 183 | 203 | PS00028 | Zinc finger | |
| IPR007087 | 211 | 231 | PS00028 | Zinc finger | |
| IPR007087 | 267 | 287 | PS00028 | Zinc finger | |
| IPR007087 | 295 | 315 | PS00028 | Zinc finger | |
| IPR007087 | 323 | 343 | PS00028 | Zinc finger | |
| IPR007087 | 351 | 371 | PS00028 | Zinc finger | |
| IPR007087 | 379 | 399 | PS00028 | Zinc finger | |
| IPR007087 | 407 | 427 | PS00028 | Zinc finger | |
| IPR007087 | 435 | 455 | PS00028 | Zinc finger | |
| IPR007087 | 463 | 483 | PS00028 | Zinc finger |
Prediction of transmembrane (TM) segments| Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 1 | GLLLLSFISTLEMLLLLVKENSM | 23 | PRIMARY | 23 |
|---|
RT-PCR-ELISA
|
Experimental conditions| Primer_f | CTATGTGAAGGGGCAAATGGG |
|---|---|
| Primer_r | TGTATCTCTCTGCCTCTAGTC |
| PCR conditions | 95 °C 30 sec 55 °C 30 sec 72 °C 60 sec 30 cycles![]() |
Chromosome No. 19
Experimental conditions| Panel name | genbank |
|---|---|
| Primer_f | - |
| Primer_r | - |
| PCR product length | - |
| PCR conditions | - |