Order Kazusa clone(s) from : ![]() |
Product ID | ORK07494 |
---|---|
Accession No | AB075828 |
Description | ZFP82 zinc finger protein |
Clone name | fh24556 |
Vector information | |
cDNA sequence | DNA sequence (5718 bp) Predicted protein sequence (487 aa) |
Source | Human fetal brain |
Rouge ID |
mKIAA1948
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 2391 bp |
---|---|
Genome contig ID | gi42406306r_41473233 |
PolyA signal sequence (AATACA,-10) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (99859 - 99810) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 19 | r | 41573092 | 41578809 | 1 | 99.0 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
BlastProDom | IPR007087 | 125 | 148 | PD000003 | Zinc finger |
IPR007087 | 153 | 176 | PD000003 | Zinc finger | |
IPR007087 | 181 | 203 | PD000003 | Zinc finger | |
IPR007087 | 209 | 232 | PD000003 | Zinc finger | |
IPR007087 | 237 | 257 | PD000003 | Zinc finger | |
IPR007087 | 265 | 288 | PD000003 | Zinc finger | |
IPR007087 | 293 | 316 | PD000003 | Zinc finger | |
IPR007087 | 321 | 344 | PD000003 | Zinc finger | |
IPR007087 | 349 | 371 | PD000003 | Zinc finger | |
IPR007087 | 377 | 399 | PD000003 | Zinc finger | |
IPR007087 | 405 | 428 | PD000003 | Zinc finger | |
IPR007087 | 433 | 456 | PD000003 | Zinc finger | |
IPR007087 | 461 | 483 | PD000003 | Zinc finger | |
HMMPfam | IPR007087 | 125 | 147 | PF00096 | Zinc finger |
IPR007087 | 153 | 175 | PF00096 | Zinc finger | |
IPR007087 | 181 | 203 | PF00096 | Zinc finger | |
IPR007087 | 209 | 231 | PF00096 | Zinc finger | |
IPR007087 | 237 | 259 | PF00096 | Zinc finger | |
IPR007087 | 293 | 315 | PF00096 | Zinc finger | |
IPR007087 | 321 | 343 | PF00096 | Zinc finger | |
IPR007087 | 349 | 371 | PF00096 | Zinc finger | |
IPR007087 | 377 | 399 | PF00096 | Zinc finger | |
IPR007087 | 405 | 427 | PF00096 | Zinc finger | |
IPR007087 | 433 | 455 | PF00096 | Zinc finger | |
IPR007087 | 461 | 483 | PF00096 | Zinc finger | |
HMMSmart | IPR015880 | 125 | 147 | SM00355 | Zinc finger |
IPR015880 | 153 | 175 | SM00355 | Zinc finger | |
IPR015880 | 181 | 203 | SM00355 | Zinc finger | |
IPR015880 | 209 | 231 | SM00355 | Zinc finger | |
IPR015880 | 237 | 257 | SM00355 | Zinc finger | |
IPR015880 | 265 | 287 | SM00355 | Zinc finger | |
IPR015880 | 293 | 315 | SM00355 | Zinc finger | |
IPR015880 | 321 | 343 | SM00355 | Zinc finger | |
IPR015880 | 349 | 371 | SM00355 | Zinc finger | |
IPR015880 | 377 | 399 | SM00355 | Zinc finger | |
IPR015880 | 405 | 427 | SM00355 | Zinc finger | |
IPR015880 | 433 | 455 | SM00355 | Zinc finger | |
IPR015880 | 461 | 483 | SM00355 | Zinc finger | |
ProfileScan | IPR007087 | 125 | 152 | PS50157 | Zinc finger |
IPR007087 | 153 | 180 | PS50157 | Zinc finger | |
IPR007087 | 181 | 208 | PS50157 | Zinc finger | |
IPR007087 | 209 | 236 | PS50157 | Zinc finger | |
IPR007087 | 237 | 264 | PS50157 | Zinc finger | |
IPR007087 | 265 | 292 | PS50157 | Zinc finger | |
IPR007087 | 293 | 320 | PS50157 | Zinc finger | |
IPR007087 | 321 | 348 | PS50157 | Zinc finger | |
IPR007087 | 349 | 376 | PS50157 | Zinc finger | |
IPR007087 | 377 | 404 | PS50157 | Zinc finger | |
IPR007087 | 405 | 432 | PS50157 | Zinc finger | |
IPR007087 | 433 | 460 | PS50157 | Zinc finger | |
IPR007087 | 461 | 487 | PS50157 | Zinc finger | |
ScanRegExp | IPR007087 | 127 | 147 | PS00028 | Zinc finger |
IPR007087 | 155 | 175 | PS00028 | Zinc finger | |
IPR007087 | 183 | 203 | PS00028 | Zinc finger | |
IPR007087 | 211 | 231 | PS00028 | Zinc finger | |
IPR007087 | 267 | 287 | PS00028 | Zinc finger | |
IPR007087 | 295 | 315 | PS00028 | Zinc finger | |
IPR007087 | 323 | 343 | PS00028 | Zinc finger | |
IPR007087 | 351 | 371 | PS00028 | Zinc finger | |
IPR007087 | 379 | 399 | PS00028 | Zinc finger | |
IPR007087 | 407 | 427 | PS00028 | Zinc finger | |
IPR007087 | 435 | 455 | PS00028 | Zinc finger | |
IPR007087 | 463 | 483 | PS00028 | Zinc finger |
Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 1 | GLLLLSFISTLEMLLLLVKENSM | 23 | PRIMARY | 23 |
---|
![]() |
Primer_f | CTATGTGAAGGGGCAAATGGG |
---|---|
Primer_r | TGTATCTCTCTGCCTCTAGTC |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | genbank |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |