KIAA1477

Product ID	ORK00236
Accession No	AB040910
Description	MAP/microtubule affinity-regulating kinase 1, transcript variant 4
Clone name	fj04927
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4638 bp) Predicted protein sequence (870 aa)
HaloTag ORF Clone	FHC00236
Flexi ORF Clone	FXC00236
Source	Human fetal brain
Rouge ID	mKIAA1477 by Kazusa Mouse cDNA Project

Length: 4638 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	1764 bp
Genome contig ID	gi89161185f_218668191
PolyA signal sequence (AATAAA,-26)	+--------+--------+----*----+---- AGTTCTCATAATAAAGCACTTGTCTTTTGCTCTTT
Flanking genome sequence (235706 - 235755)	----+--------+--------+--------+--------+----* ATCAGAATGTGAATTACCTGTTTTCTGGTACAAAAGTATTCTGTATGAGG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	1	f	218768191	218903895	16	99.5	Perfect prediction

Length: 870 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAG11330	1.9e-209	100.0	serine/threonin...	synthetic construct
CAH72462	4.8e-209	99.9	MAP/microtubule...	Homo sapiens
EAW93298	1.9e-176	97.1	MAP/microtubule...	Homo sapiens
XP_525067	2.1e-175	96.5	MAP/microtubule...	Pan troglodytes
XP_001172814	7.9e-173	95.8	MAP/microtubule...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB058763	4.5e-34	54.9	KIAA1860
AB023216	4.9e-18	51.7	KIAA0999
AB018324	5.2e-17	50.6	KIAA0781
AB058714	7.4e-13	32.3	KIAA1811
AB011109	8e-12	29.6	KIAA0537

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR000719	172	401	PD000001	Protein kinase
HMMPfam	IPR000719	172	401	PF00069	Protein kinase
	IPR000449	421	460	PF00627	Ubiquitin-associated/Translation elongation factor EF1B
	IPR001772	821	870	PF02149	Kinase-associated KA1
HMMSmart	IPR001245	172	400	SM00219	Tyrosine protein kinase
	IPR002290	172	401	SM00220	Serine/threonine protein kinase
	IPR000449	422	459	SM00165	Ubiquitin-associated/Translation elongation factor EF1B
ProfileScan	IPR000719	172	401	PS50011	Protein kinase
	IPR000449	415	460	PS50030	Ubiquitin-associated/Translation elongation factor EF1B
	IPR001772	821	870	PS50032	Kinase-associated KA1
ScanRegExp	IPR000719	178	201	PS00107	Protein kinase
ScanRegExp	IPR008271	268	280	PS00108	Serine/threonine protein kinase

Primer_f	AAAGACCTCAGGCTAACAGTG
Primer_r	TATTCCTTCTTGCCATGCTAC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	CGAGCCAGGCAGTGATTTGAG
Primer_r	GGTATGCGGACAGTAACGAGG
PCR product length	178 bp
PCR conditions	95 °C15 sec66 °C60 sec30 cycles