KIAA1483

Product ID	ORK07398
Accession No	AB040916
Description	zinc finger and BTB domain containing 2
Clone name	fj06303
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (2692 bp) Predicted protein sequence (428 aa)
Source	Human fetal brain
Rouge ID	mKIAA1483 by Kazusa Mouse cDNA Project

Length: 2692 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	1403 bp
Genome contig ID	gi89161210r_151626945
PolyA signal sequence (AATAAA,-22)	+--------+--------+----*----+---- CATCCTTTCATTGAATAAACGTTTAATTAAATGAG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* TATATGATGTCATGTCATCTCTGCGTCTTTGTCTACCCAAAGAGATACAG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	6	r	151726945	151729637	1	99.0	Perfect prediction

Length: 428 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
EAW47752	6.4e-148	99.8	zinc finger and...	Homo sapiens
CAH56321	6.6e-148	99.8	hypothetical pr...	Homo sapiens
Q8N680	7.3e-148	99.8	Zinc finger and...	Homo sapiens
XP_001136407	1.2e-147	99.3	zinc finger and...	Pan troglodytes
XP_527539	1.4e-147	99.3	zinc finger and...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB095924	0.00017	26.4	KIAA2003
AB014528	0.00028	28.3	KIAA0628
AB033024	0.00038	30.4	KIAA1198
AB002324	0.00039	24.4	KIAA0326
AB037852	0.00044	27.9	KIAA1431

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR007087	168	190	PF00096	Zinc finger
HMMPfam	IPR007087	277	299	PF00096	Zinc finger
HMMSmart	IPR015880	168	190	SM00355	Zinc finger
	IPR015880	277	299	SM00355	Zinc finger
	IPR015880	304	324	SM00355	Zinc finger
ProfileScan	IPR007087	168	192	PS50157	Zinc finger
ProfileScan	IPR007087	277	304	PS50157	Zinc finger
ScanRegExp	IPR007087	170	190	PS00028	Zinc finger
ScanRegExp	IPR007087	279	299	PS00028	Zinc finger

Primer_f	ATGGCAAAGAGAAATCAGGAC
Primer_r	TTACTGCTTTCGGGCCAATGG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	unigene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-